Application of OG1 gene in biological CO2 capturing

A CO2 and gene technology, applied in the application field of OG1 gene in biological capture of CO2, can solve the problems of low carbon sequestration efficiency and high environmental conditions, and achieve the effect of high carbon sequestration efficiency

Inactive Publication Date: 2016-08-31
SUN YAT SEN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, microbial fixation of CO 2 There are still some problems, such as low carbon fixation efficiency, high environmental conditions required for the fixation process, etc. Therefore, improving the efficiency of biological carbon fixation, simplifying its environmental requirements for carbon fixation, and expanding the application of microbial carbon fixation are the future of microbial carbon fixation technology and its widespread It plays a very important role in the development direction of the application, and at the same time, it plays a very important role in dealing with global warming

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of OG1 gene in biological CO2 capturing
  • Application of OG1 gene in biological CO2 capturing
  • Application of OG1 gene in biological CO2 capturing

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Carbon fixation isotope experiment According to carbon 13 Urea breath test design

[0029] The OG1 gene sequence is stored in Genbank, and its Genbank sequence number is NC_012920, with bases 9251 to 9655.

[0030] The preparation process of Escherichia coli pOG1 is as follows:

[0031] Human mitochondrial DNA was amplified by conventional PCR with primers F0 and PB2 (containing restriction sites).

[0032] F0:

[0033] GACGGTATCGATAAGCTTGATATCGAATTCATGACCCCTAACAGGGGC

[0034] PB2: ACTAGTGGATCCCCCGGGCTGCAGCTATGGTGAGCTCAGGTGATTGATACTCCTGATGC

[0035] The OG1 fragment recovered from the gel and the SK-plasmid were both digested with BamH I and EcoRI, and the purified digested product was digested with T 4 DNA ligase ligation, and the ligation product was directly transformed into Escherichia coli MG1655 strain. Spread on LB / AMP / ITPG / X-Gal plates and culture overnight at 37°C. Pick the white clone. The pOG1 subclone was sent to BGI for sequencing, and th...

Embodiment 2

[0050] Example 2 Utilize nitrogen source, carbon fixation coating experiment

[0051] C8 carbon-fixing solid medium: 40 mg of YNB (no amino acid and no ammonium sulfate), 5 mg of imported or analytically pure ammonium sulfate, 4 g of agar, dissolved in 80 ml of double distilled water, adjust the pH value to 8.0 with NaOH, and dilute to 100 ml.

[0052] The experimental process of using nitrogen source and carbon fixation coating is as follows:

[0053] Pick Escherichia coli MG1655, pOG1, SK- single colonies and culture them overnight for about 12 hours, take 20-30 microliters of the culture solution, centrifuge, wash with sterile water, and smear the plate. MG1655 without ampicillin, SK and pOG1 clone growth plates were supplemented with ampicillin at a concentration of 100mg / L. The plate was cultured in a 30°C incubator, and the parafilm was poked with a pipette tip to allow CO 2 Enter, record the growth time and take pictures after the colony grows out.

[0054] The resul...

Embodiment 3

[0055] Example 3 The experiment of consuming protons

[0056] Inoculate 0.1OD (absorbance value at 600nm, about 1×10 8 cells / mL) Escherichia coli clones in 6 tubes, 5 ml medium (medium formula: 300ml system, with 0.2g peptone, 0.1g yeast powder), cultured at 37 degrees 220rpm for 6 hours, measured OD 600nm The absorbance value was measured, and the pH of the medium was detected with a pH meter. The results are shown in Table 3.

[0057]

[0058] Escherichia coli culture generally becomes acidified gradually. In Table 2, the density of pOG1 bacteria is higher, but the pH is also higher (the culture medium is relatively more alkaline). It shows that the pOG1 cell consumes protons. The difference in pH between the two groups was statistically significant, P=0.05 (one-tailed).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the biotechnology field, and discloses an application of an OG1 gene in biological CO2 capturing. The sequence of the OG1 gene is as shown in SEQ ID NO:1; when the gene is introduced into a genetically engineered bacterium, biological capturing on CO2 in atmosphere can be achieved; the genetically engineered bacterium with the gene is high in carbon sequestration efficiency, and has the potential of making contribution to treatment on global warming.

Description

technical field [0001] The present invention relates to the field of biotechnology, more specifically, relates to the role of OG1 gene in biological capture of CO 2 in the application. Background technique [0002] Climate change is one of the focal issues of global concern, among which global warming is the most prominent. The massive burning of fossil fuels and large-scale destruction of forests have led to an increase in the concentration of carbon dioxide in the atmosphere, leading to the greenhouse effect. It is reported that in the past 100 years, the average global surface temperature has increased by about 0.3-0.6°C, leading to global warming and a series of serious consequences, such as melting glaciers, rising sea levels, and endangering rare species. [0003] As a safe, economical and effective carbon sequestration method, biological carbon sequestration has attracted widespread attention from the international community and has become a hotspot of interdiscipli...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/52C12N9/00C12N15/70
CPCC12N9/00C12N15/70C12N2800/101
Inventor 刘秋云何建国翁少萍周艳超喜仁·奴尔太欧阳岚易啸甘滔齐进焕杨帆
Owner SUN YAT SEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap