Method for solid-phase synthesis of DNA-coded compound database

A solid-phase synthesis, compound library technology, applied in the direction of organic compound library, DNA preparation, recombinant DNA technology, etc., can solve the problems of long cycle, poor solubility, limited synthesis reaction types, etc.

Active Publication Date: 2016-10-26
HITGEN INC
View PDF5 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Although the synthesis and encoding technology of the existing DNA-encoded compound library can be well applied to the screening of lead drugs, it also has some shortcomings and limitations: 1) To a large extent, the DNA used for encoding is suitable for aqueous phase (or an aqueous phase containing a water-miscible organic solvent) reaction, the reaction molecules have poor solubility in pure organic solvents, and cannot be used for water-sensitive pure organic phase chemical reactions, which limits the types of synthetic reactions that can be used for DNA-encoded compound libraries , which reduces the rate of synthetic chemical reactions for DNA-encoded compound libraries
2) In order to promote the nearly complete conversion of each step of the synthesis reaction, the synthesis of DNA-encoded compound libraries often uses a large excess of small molecule reaction reagents, which are difficult to completely separate from the aqueous phase-based DNA-encoded compound library synthesis system
3) During the library synthesis process of the compound DNA library based on the liquid phase reaction, in order to meet the purity requirements of the DNA compound library, the separation and purification steps after the DNA library synthesis reaction are numerous and the cycle is long
[0008] At present, the existing "DNA-encoded combinatorial chemical synthesis method" under solid-phase conditions is limited to peptide synthesis, and the types of applicable chemical reactions are relatively limited
At the same time, the force between the solid-phase carrier and DNA is mainly derived from ionic interactions. It is difficult for it to exist stably in high-concentration salt systems or other systems that affect ionic interactions, which greatly limits its application in small molecules. Applications in the Synthesis of Compound Libraries

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for solid-phase synthesis of DNA-coded compound database
  • Method for solid-phase synthesis of DNA-coded compound database
  • Method for solid-phase synthesis of DNA-coded compound database

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0141] (1), preparation of L-G-1

[0142]

[0143]To G-1 (0.5g, CPG initial load: 32μmol / g, source: Shanghai Lingjiang Industrial Development Co., Ltd.), add 3mL dichloromethane containing compound L-1 (69mg, 0.1mmol; manufacturer: Aldrich) Methane solution was reacted overnight at room temperature; after the reaction was completed, the solvent was removed by filtration to obtain a solid; the solid was washed with DMF (2 mL×3) and dichloromethane (2 mL×3) respectively to obtain L-G-1.

[0144] Take L-G-1, remove the Fmoc protecting group with piperidine, and use the UV absorption quantification of the elimination product of Fmoc to determine that the load of L-G-1 is 14.5 μmol / g, and the yield is 91%.

[0145] (2), preparation of L-2

[0146]

[0147] Dissolve single-stranded DNA (32.0 nmol, molecular weight 7663.9) (the sequence of single-stranded DNA is GGAGCTTGTGAATTCTGGCACTCG) in 30 μL NaHCO 3 To the buffer solution, add 20 ml of L-0 (1.0 mg, 3.0 μmol; manufacturer...

Embodiment 2

[0173] (1) According to the preparation method of L-G-1 in Example 1, L-G-1 was obtained;

[0174] (2) According to the preparation method of L-2 in Example 1, L-2 was obtained;

[0175] (3) According to the preparation method of L-G-2 in Example 1, L-G-2 was obtained;

[0176] (4) According to the preparation method of L-G-2-1 in Example 1, L-G-2-1 was obtained;

[0177] (5) Preparation of L-G-3-1.b

[0178]

[0179] Add 2-ethylphenylisocyanate (1.47 mg; manufacturer: Alfa), triethylamine (5 μL) and DMF (15 μL) to L-G-2-1 (5.0 mg), and react at 25°C to 30°C for 16 hours, The solvent was removed by filtration to obtain a filter cake; the filter cake was washed three times with distilled water and 0.1M TEAA buffer solution respectively to obtain L-G-2-1-1.b;

[0180] Take part of L-G-2-1-1.b (2.0 mg) and add 150 μL of concentrated ammonia water, heat to 55 ° C for 1 hour to remove the solid phase carrier, filter and distill off the solvent under reduced pressure, and wash...

Embodiment 3

[0187] (1) According to the preparation method of L-G-1 in Example 1, L-G-1 was obtained;

[0188] (2) According to the preparation method of L-2 in Example 1, L-2 was obtained;

[0189] (3) According to the preparation method of L-G-2 in Example 1, L-G-2 was obtained;

[0190] (4) According to the preparation method of L-G-2-1 in Example 1, L-G-2-1 was obtained;

[0191] (5) Preparation of L-G-2-2.c

[0192]

[0193]To L-G-2-1 (20mg), add p-aminobenzoic acid (4.15mg, manufacturer: Alfa), 2-(7-azobenzotriazole)-N,N,N',N'-tetra Methylurea hexafluorophosphate (6.9 mg, manufacturer: Alfa), DIEA (20 μL) and DMF (60 μL), stirred and reacted at 25° C. to 30° C. for 16 hours, and filtered to remove the solvent to obtain a filter cake; the filter cakes were respectively Wash three times with distilled water and 0.1M TEAA buffer solution to obtain L-G-2-2.c;

[0194] Take part of L-G-2-2.c (2.0 mg) and add 150 μL of concentrated ammonia water, heat to 55 ° C for 1 hour to remove...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for solid-phase synthesis of a DNA-coded compound database. The method comprises the following steps: a, reacting a solid-phase carrier G-1 with a junctional molecule L-1 so as to prepare L-G-1; b, reacting DNA with a junctional molecule L-0 so as to prepare L-2; c, reacting L-G-1 with L-2 to prepare L-G-2; d, removing the protective group of L-G-2 so as to obtain L-G-2-1; e, reacting L-G-2-1 with a synthesized building block and carrying out DNA coding; and f, cutting off a solid-phase carrier so as to obtain the DNA-coded compound database. Compared with the prior art, the method has the advantage that aftertreatment purification of a reaction can be completed through simple filtering and washing operations a plurality of times; operation is simple; a production period for synthesis of the DNA-coded compound database is reduced by 50% or above, production efficiency and uniqueness of the DNA-coded compound database can be substantially improved, and the purity of the final products is greatly enhanced; and the method has high economic value and is suitable for industrial application.

Description

technical field [0001] The invention relates to a method for solid-phase synthesis of a library of DNA-encoded compounds. Background technique [0002] In drug development, especially new drug development, high-throughput screening for biological targets is one of the main means to quickly obtain lead compounds. However, the traditional high-throughput screening based on a single molecule requires a long time, huge investment in equipment, limited number of library compounds (millions), and the construction of a compound library requires decades of accumulation, which limits the efficiency and efficiency of lead compound discovery. possibility. The DNA-encoded compound library synthesis technology that has emerged in recent years combines combinatorial chemistry and molecular biology techniques to add a DNA tag to each compound at the molecular level, and can synthesize hundreds of millions of compound libraries in a very short period of time. Moreover, compounds can be id...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C40B40/06C40B20/04C40B70/00C40B50/04C40B50/16
CPCC40B20/04C40B40/06C40B50/04C40B50/16C40B70/00C12N15/1068C12P19/34
Inventor李进万金桥刘观赛钟丽娜陈仰王志刘欣城穆云窦登峰
OwnerHITGEN INC