Unlock instant, AI-driven research and patent intelligence for your innovation.

Efficient co-production strategy of L-phenylglycine and gluconic acid

A technology of gluconic acid and phenylglycine, applied in the field of microorganisms, can solve the problems of long fermentation time, strict control of fermentation conditions, low energy consumption, etc., and achieve the effect of fast and efficient conversion process and important industrial application value.

Active Publication Date: 2016-11-16
JIANGNAN UNIV
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The production of gluconic acid mainly includes microbial fermentation, electrolysis and catalytic oxidation. Among them, microbial fermentation is widely used because of its environmental friendliness and low energy consumption, but there are also problems such as long fermentation time and strict control of fermentation conditions.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Efficient co-production strategy of L-phenylglycine and gluconic acid
  • Efficient co-production strategy of L-phenylglycine and gluconic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Preparation of Escherichia coli Competent and Transformation of Plasmid

[0040] [1] Preparation of competent Escherichia coli. Activate the monoclonal Escherichia coli in 10ml LB medium, then transfer to 37°C shaking culture to OD 600 0.35 to prepare the competent state; put the cultured bacterial solution in ice water, shake gently to cool the bacterial solution for about 10 minutes; prepare several 1.5ml centrifuge tubes for sterilization, and divide the bacterial solution into the tubes, The amount of bacteria in the tube is 1.2ml, put the centrifuge tube in ice; centrifuge the bacteria solution at 8000r / min for 10-20s, let it stand in ice water for 2min, discard the supernatant, add pre-cooled 0.1M CaCl 2 400μL, gently blow the suspension, put it in ice for 15min (repeat this step 2-3 times); finally, add pre-cooled 0.1M CaCl 2 80 μL, gently pipette the suspension and place it on ice.

[0041] [2] Transformation of plasmids. Take the competent cel...

Embodiment 2

[0042] Example 2: Construction and transformation of recombinant plasmid pET-28a-Bsleudh / pET-28a-Bcleudh / pET-28a-Blleudh / pET-28a-Baleudh / pET-28a-Heleudh / pET-28a-Nmleudh

[0043] [1] Genomic DNA of Bacillus subtilis, Bacillus cereus, Bacillus licheniformis, Bacillus amyloliquefaciens, Halomonas longum and halophilic archaea were used as templates.

[0044] [2] According to the L-leucine dehydrogenase gene sequence of Bacillus subtilis, Bacillus cereus, Bacillus licheniformis, Bacillus amyloliquefaciens, Halomonas longum and halophilic archaea and the pET-28a plasmid Design the primers of leudh gene according to the restriction site.

[0045] PBsldhF: CGGGATCCATGGAACTTTTTAAATATATG (BamHI)

[0046] PBsldhR: CCCAAGCTT TTAACGTCTGCTTAATACACTGT (HindIII)

[0047] PBcldhF: CGGGATCCATGACATTAGAAATCTTCGA (BamHI)

[0048] PBcldhR: CCCTCGAGTTAGCGACGGCTAATAATATCG(XhoI)

[0049] PBlldhF: CGGGATCCATGGAACTATTTCGATATATGGA (BamHI)

[0050] PBlldhR: CCCAAGCTT TTAACGTCTGCTTAAAATGTGA (HindIII)...

Embodiment 3

[0060] Example 3: Construction and transformation of recombinant plasmid pET-28a-Bmgdh / pET-28a-Bsgdh / pET-28a-Btgdh

[0061] [1] Genomic DNA of Bacillus megaterium, Bacillus subtilis and Bacillus thuringiensis were used as templates.

[0062] [2] Design gdh gene primers based on the glucose dehydrogenase gene sequences of Bacillus megaterium, Bacillus subtilis and Bacillus thuringiensis and the restriction sites on the pET-28a plasmid.

[0063] PBmgdhF: CGGAATTCATGTATACAGATTTAAAAGATA (EcoRI)

[0064] PBmgdhR: CCCAAGCTTTTAACCTCTTCCCGCTTGGAAAG (HindIII)

[0065] PBsgdhF: CGGAATTCATGTATCCGGATTTAAAAGGAAA (EcoRI)

[0066] PBsgdhR: CCCAAGCTTTTAACCGCGGCCTGCCTGGAAT (HindIII)

[0067] PBtgdhF: CGGAATTCATGTATAGTGATTTAGAAGGAA (EcoRI)

[0068] PBtgdhR: CCCAAGCTTTTACCCCACGTCCAGCTTGAAAC (HindIII)

[0069] [3] Using the genomic DNA of Bacillus megaterium, Bacillus subtilis and Bacillus thuringiensis as templates, the gdh gene was amplified by PCR. PCR amplification system: template 2 μL...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for co-producing L-phenylglycine and gluconate through single expression and co-expression of glucose dehydrogenase and L-leucine dehydrogenase in escherichia coli through utilizing a recombinant escherichia coli enzyme method and a whole cell method. The method is as follows: a glucose dehydrogenase gene and an L-leucine dehydrogenase gene are used for constructing recombinant single expression and co-expression carriers and are transformed into a gene engineering bacterium, namely the escherichia coli. The circulation of cofactors in a transformation system can be promoted through utilizing a recombinant bacterium enzyme method and the whole cell method; only a few of exogenous cofactors are added or the exogenous cofactors do not need to be used, and the L-phenylglycine and gluconic acid, which have high additional value, are co-produced by substrates including benzoylformic acid and glucose through utilizing a cofactor cyclic regeneration system; a transformation process is simple and rapid and low in cost. When transformation is carried out in a 5L fermentation tank for 2h to 4h, the yields of the L-phenylglycine and the gluconic acid, obtained by the method, can respectively reach 58.8g / L and 75.6g / L, and an actual and effective strategy is provided for industrial production.

Description

technical field [0001] The invention belongs to the technical field of microorganisms, and in particular relates to a method for constructing an NADH coenzyme circulation system by separately and co-expressing glucose dehydrogenase and L-leucine dehydrogenase in Escherichia coli, and efficiently preparing L - Phenylglycine and gluconate methods. Background technique [0002] Phenylglycine and its derivatives are important pharmaceutical intermediates, which can be used in the synthesis of ampicillin, cephalexin, cefaclor, amoxicillin, benzamicillin and other lactam antibiotics. O-chlorophenylglycine is an important intermediate in the synthesis of the antiplatelet inhibitor clopidogrel. In addition, phenylglycine is also an important intermediate for the synthesis of polypeptide hormones and various chiral pesticides. With the rapid development of my country's pharmaceutical and chemical industry, it is believed that the demand for phenylglycine and its derivatives will con...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12P13/22C12P7/58
CPCC12N9/0006C12N9/0016C12N15/70C12P7/58C12P13/222C12Y101/9901C12Y104/01009
Inventor 饶志明刘巧利周俊平杨套伟张显徐美娟
Owner JIANGNAN UNIV