Gossypium hirsutum non-specific phospholipase C gene GhNPC6d and application thereof
A non-specific, phospholipase technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of non-specific phospholipase C in cotton, and little research on the function of non-specific phospholipase C, so as to improve the stress resistance characteristics Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1. High-fidelity PCR amplification of the GhNPC6d target gene
[0022] The young leaves and roots of 9807 four-leaf stage in upland cotton were taken, and total plant RNA was extracted according to the instructions of the total plant RNA extraction kit (TIANGEN, Beijing), and reverse transcription kit was used for reverse transcription with PrimeScript RT Reagent Kit (TaKaRa, Dalian). Transcribed to obtain cDNA. High-fidelity PCR amplification with specific primers. The specific primer sequences are as follows:
[0023] GhNPC6d-F: TCTAGAATGGAGCGCTCATTTTCTT
[0024] GhNPC6d-R: CGAGCTCTTACGGATTCGAAGATCTCGT
[0025] The total volume of the PCR reaction is 25 μL, and the reaction system is: 5 μL 5×PS Buffer, 2 μL dNTP, 0.5 μL forward primer, 0.5 μL reverse primer, 0.25 μL Prime STARase, 1 μL ten-fold diluted cDNA template, ddH2O filled to 25 μL .
[0026] PCR amplification conditions, pre-denaturation at 95°C for 3min, 35 cycles: 98°C, 10sec; 56°C, 5sec; 72°C, ...
Embodiment 2
[0030] Example 2. GhNPC6d gene bioinformatics analysis
[0031] Use the ExPASy proteomics server database to estimate the molecular weight and isoelectric point of GhNPC6d; use Gene Structure Display Server 2.0 to analyze the GhNPC6d gene structure; use MEME to analyze the conserved motif of GhNPC6d, and use the ScanProsite tool in ExPASy to annotate the obtained motif; use NCBIConserved Domain The conserved domain of GhNPC6d was analyzed online by search and SMART, and the promoter of GhNPC6d was analyzed by Plant CARE.
[0032]After bioinformatics analysis, it was found that the GhNPC6d gene was located on the D07 chromosome, the number of amino acids was 509, the theoretical molecular weight of GhNPC6d was 56.80kD, and the theoretical isoelectric point was 6.74. Contains 3 exons and 2 introns. MEME analysis found that GhNPC6d has 16 motifs. The obtained motifs were further analyzed in ExPASy, and it was found that 6 motifs were annotated as phosphate domains. Using NCBI ...
Embodiment 3
[0033] Example 3. GhNPC6d tissue-specific analysis
[0034] Upland cotton (variety Zhong 9807) seeds were sterilized and planted in a greenhouse under the following growth conditions: 30°C / 25°C, 60-70% relative humidity, 14 hours of light, 10 hours of darkness, and a photon flux density of 800 μmol m -2 the s -1 . When growing to the four-leaf stage, take the main root, lateral root, stem, shoot tip, cotyledon, senescent leaves and young leaves and store them in liquid nitrogen at -80°C; grow to the flowering stage, take the bracts, Petals and ovules were stored in liquid nitrogen at -80°C. Total plant RNA was extracted and reverse transcribed to obtain cDNA, which was diluted 10 times and used for real-time fluorescent quantitative PCR analysis. Upland cotton Histone gene (GenBank accession number NC_006639) was used as the internal standard. Fluorescence quantitative PCR reaction kit is TAKARA's SYBR Premix Ex Taq Ⅱ kit, the reaction is in 96 System Fluorescence Quanti...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Theoretical molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More