CYP101 enzyme recombinant vector, construction method thereof and CYP101 enzyme high-efficiency expression and purification method

A recombinant vector and high-efficiency expression technology, which is applied in the field of CYP101 enzyme recombinant vector and construction, high-efficiency expression and purification of CYP101 enzyme, can solve the problems of reduced enzyme activity, low protein purity, and difficulty in ensuring enzyme activity, and achieve high expression level and protein structure. small effect

Inactive Publication Date: 2017-03-15
SHANGHAI JIAO TONG UNIV
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In traditional purification methods, in order to obtain high-purity enzymes, more than three purification methods are often used. The purification time is long, resulting in greatly reduced enzyme activity, and multi-step purification also leads to low recovery efficiency.
Fewer purification methods will lead to relatively low purity of the purified target protein, which cannot meet the ideal requirements of technicians
According to previous literature reports, in the construction of vectors for CYP101, in order to facilitate cloning and purification, longer purification tags, such as GST, MBP, Halo and other fusion expression tags, containing tens to hundreds of amino acid residues were used; or using Short purification tags, such as 6*His (6 amino acid residues), flag (8 amino acid residues), avidin (15 amino acid residues), and a longer linker peptide is added between the short tag and the target protein Due to the introduction of these short tags, the final target protein has at least 10 more amino acids than the natural protein, which is different from the natural structure and may affect the properties or functions of the target protein
[0005] In the purification process of CYP101 enzyme, a tag is introduced for the convenience of purification. Although protease can be used to remove the tag after purification to ensure the similarity with the natural protein, the enzyme digestion operation is cumbersome and costly, and it is often difficult to use in a large number of purified samples.
At the same time, the enzyme digestion step increases the purification time, making it difficult to guarantee the activity of the enzyme

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CYP101 enzyme recombinant vector, construction method thereof and CYP101 enzyme high-efficiency expression and purification method
  • CYP101 enzyme recombinant vector, construction method thereof and CYP101 enzyme high-efficiency expression and purification method
  • CYP101 enzyme recombinant vector, construction method thereof and CYP101 enzyme high-efficiency expression and purification method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] Example 1: Vector construction of PET28a-CYP101

[0080] 1. Template: extract the whole genome of Pseudomonas putida and use it as a template for PCR amplification reaction. The source of this example is 700412 TM , this product is a mature product and can be purchased directly.

[0081] 2. PCR amplification: using the whole genome of Pseudomonas putida as a template, the amplification product is obtained through PCR amplification reaction;

[0082] Among them, the designed upstream and downstream primer sequences are respectively:

[0083] Upstream primer F: CCGCCATGGCGATGGTTCCCAGCGACCTGTATC

[0084] Downstream primer R: GCGGCGGCCGCCTCGCTGTCAAACTTAATAGPCR

[0085] The PCR reaction system includes: 10× amplification buffer (containing Mg 2+ ) 5 μl, 2.5M dNTP mix 2 μl, 10 μM primer 1 μl, template DNA 2 μl, Taq DNA polymerase 1 μl, add ddH2O to 50 μl.

[0086] After mixing the components of the reaction system, put them into the PCR instrument, and set the cycle c...

Embodiment 2

[0094] Example 2: Massive Induced Expression of CYP101

[0095] 1. Transformation: Transform 2 μl of the recombinant plasmid PET28a-CYP101 into Escherichia coli BL21-plysS competent bacteria, and streak it on the Kanabio LB solid medium plate, and place it in a constant temperature incubator at 37°C for 12-16 hours.

[0096] 2. Seed culture: Pick the monoclonal colony and culture it in a 20ml LB liquid medium flask with shaking at 37°C, shake the bacteria overnight at 250rpm.

[0097] 3. Expanded culture: Transfer the bacterial solution obtained in step 2 to 1LTB medium containing Cannabidiol at an inoculation ratio of 1:500, add 250 μl trace elements (trace elements, known products purchased directly), 37°C , 200rpm shaking culture.

[0098] 4. Induced expression: Cultivate the Erlenmeyer flask under the above conditions for nearly 3 hours until OD600=0.5-0.7, take 1ml of bacterial liquid as a negative control, and add IPTG (isopropyl-β- D thiogalactoside, Amresco 367-93-1)...

Embodiment 3

[0100] Embodiment 3: Purification of CYP101 protein

[0101] The whole process of purification of CYP101 protein was performed on ice.

[0102] A. Preparation of cell supernatant

[0103] a1. Bacteria resuspension: the bacteria collected in Example 2 were resuspended with cold buffer A (50 mM potassium phosphate, 50 mM potassium chloride, pH 7.4) (slowly blown on ice to homogenize).

[0104] a2. Lysozyme treatment: add lysozyme at a final concentration of 2 μg / ml, add PMSF protease inhibitor at a ratio of 1:200, and let stand on ice for 30 minutes.

[0105] a3. Ultrasonic crushing: Ultrasonic crushing, ultrasonic for 3 seconds, stop for 7 seconds, cycle mode, until the bacteria are clarified.

[0106] a4. High-speed centrifugation: 16000rpm, 15 minutes, centrifuge the broken liquid for 15 minutes at 4°C, collect the supernatant, repeat the centrifugation once, and collect the supernatant;

[0107] a5. Membrane filtration: The above supernatant must be filtered with a 0.45 μ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a CYP101 enzyme recombinant vector, a construction method thereof and a CYP101 enzyme high-efficiency expression and purification method, and belongs to the field of biotechnology. A PET28a-CYP101 high-efficiency expression vector is constructed and transformed into BL21 plysS strain, and high-purity enzyme with purity higher than 95% is obtained by a simple two-step purification method including affinity chromatography and ion exchange chromatography after inducible expression. Compared with the prior art, CYP101 is simply and efficiently produced, the cost is low, purification is facilitated, and 23mg of target protein with the purity higher than 95% can be obtained by per liter of culture media. The CYP101 enzyme high-efficiency expression and purification method can be used for expressing and purifying CYP101 enzyme, the production efficiency of a laboratory is greatly improved, and experimental cost is greatly reduced. The CYP101 enzyme high-efficiency expression and purification method has an excellent application prospect for large-scale CYP101 enzyme production and purification.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a CYP101 enzyme recombination vector and a construction method, and a CYP101 enzyme high-efficiency expression and purification method. Background technique [0002] Cytochrome P450 (cytochrome P450, referred to as CYP450) is a superfamily of heme-thiolate proteins, which widely exist in various organisms in nature. Metabolism of xenobiotics. Its participation process can be roughly divided into three aspects: the synthesis of hormone substances in the body, the metabolism of exogenous substances and the decomposition of fatty acids. They were first discovered by Garfinkel and Klingenberg from mammalian liver microsomes in 1958. They were named because they can bind CO in a reduced state and detect an obvious absorption peak at a wavelength of 450nm after binding. Cytochrome P450 enzymes. Molecular biology techniques have been applied to the study of cytochrome P450, and the use o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N1/21C12N15/66C12N9/02
CPCC12N15/70C12N9/0077C12N15/66C12Y114/15001
Inventor黄娟徐沁洪亮
OwnerSHANGHAI JIAO TONG UNIV