Unlock instant, AI-driven research and patent intelligence for your innovation.

Short-chain dehydrogenase and gene thereof, recombinant expression vector, genetically engineered bacterium and application thereof in astaxanthin chiral intermediate synthesis

A technology of short-chain dehydrogenase and genetically engineered bacteria is applied in the application field of short-chain dehydrogenase and its gene, astaxanthin chiral intermediate synthesis, and can solve the limitation of extraction and reuse of crustacean astaxanthin, The yield of astaxanthin has not been improved by a breakthrough, and the research on the secondary metabolism mechanism is not in-depth, so as to achieve the effect of good application and development prospects, easy preparation, and environmental friendliness.

Active Publication Date: 2017-03-22
杭州馨海酶源生物科技有限公司
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the extraction and reuse of crustacean astaxanthin are limited due to the high chitin and ash content, low concentration of protein and other nutrients in the crustacean’s carapace.
On the other hand, although the astaxanthin production of microorganisms (Phaaffia rhodozyme and Haematococcus pluvialis, etc.) can be improved through various ways such as strain selection and fermentation condition optimization, due to the secondary effect on the synthesis of astaxanthin The research on the mechanism of metabolites is not deep enough, and the production of astaxanthin has not been improved in a breakthrough way.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Short-chain dehydrogenase and gene thereof, recombinant expression vector, genetically engineered bacterium and application thereof in astaxanthin chiral intermediate synthesis
  • Short-chain dehydrogenase and gene thereof, recombinant expression vector, genetically engineered bacterium and application thereof in astaxanthin chiral intermediate synthesis
  • Short-chain dehydrogenase and gene thereof, recombinant expression vector, genetically engineered bacterium and application thereof in astaxanthin chiral intermediate synthesis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Acquisition of Pseudomonas putida ATCC 12633 short-chain dehydrogenase gene, recombinant plasmid construction and transformation into Escherichia coli

[0040] The whole genome DNA of Pseudomonas putida ATCC 12633 bacterium was extracted with a DNA extraction kit, and the DNA was used as a template, and upstream primers (GCTGA GGATCC ATGGCTAATGCAAAAACCGC) and downstream primers (GCATC CTCGAG TCACCAGACCAAGGGTTCGC) was used as primer for PCR amplification reaction. The amount of each component in the PCR reaction system (total volume 50μL): 5×PrimeSTAR TM 10 μL of HS DNA polymerase buffer, 4 μL of 10 mM dNTP mixture (dATP, dCTP, dGTP and dTTP each 2.5 mM), 1 μL of each upstream primer and downstream primer at a concentration of 50 μM, 1 μL of genomic DNA, PrimeSTAR TM HS DNA polymerase 0.5μL, nucleic acid-free water 32.5μL. The PCR reaction conditions were as follows: pre-denaturation at 98°C for 1min, followed by a temperature cycle of 98°C for 10s, 56°C...

Embodiment 2

[0043] Example 2: Induced expression of recombinant short-chain dehydrogenase

[0044] The engineered bacterium E.coli BL21(DE3) / pET30a-Ppysdr constructed in Example 1 was inoculated into LB liquid medium containing 50 μg / mL kanamycin, cultivated overnight at 37° C., and then inoculated with 1% inoculum (v / v ) was inoculated into 50mL LB medium containing 50μg / mL kanamycin, cultivated at 37°C and 200rpm to the cell concentration OD 600 When the concentration reaches about 0.6, add IPTG with a final concentration of 0.1 mM, induce culture at 26°C for 6 hours, then centrifuge at 8000 rpm at 4°C for 10 minutes to collect the bacterial cells, and store them at -80°C for later use.

Embodiment 3

[0045] Embodiment 3: Separation and purification of recombinant short-chain dehydrogenase

[0046] The thalli cells that embodiment 2 collects are suspended in 10mL Na 2 HPO 4 -NaH 2 PO 4 In buffer solution (100mM, pH 8.0), shake well and then crush under ultrasonic wave (effective time 8min). The broken liquid was centrifuged at 12,000 rpm for 10 min to remove cell debris, and the supernatant (crude enzyme liquid) was collected for subsequent separation and purification of the enzyme. The purification column is Ni-NTA, and the column volume is 5mL. First equilibrate the Ni-NTA column with loading equilibration buffer (20mM sodium phosphate, 500mM NaCl and 20mM imidazole, pH 7.4), and load the crude enzyme at a rate of 5mL / min. solution, eluted with loading equilibration buffer to remove unadsorbed protein, and finally eluted with elution buffer (20mMT sodium phosphate, 500mM NaCl and 500mM imidazole, pH 7.4) to collect the target protein. The enzyme liquid is desalted wi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a short-chain dehydrogenase and a gene thereof, a recombinant short-chain dehydrogenase, a recombinant expression vector containing the gene, a genetically engineered bacterium, a preparation method of the recombinant short-chain dehydrogenase, and an application of the short-chain dehydrogenase or the genetically engineered bacterium containing the short-chain dehydrogenase in astaxanthin chiral intermediate synthesis through asymmetric reduction for prochiral ketones. In the application provided by the invention, asymmetric reduction preparation of the short-chain dehydrogenase for chiral alcohols has remarkable advantages, and an astaxanthin chiral intermediate (having an enantiomeric excess (ee) of greater than 99%) with a high optical purity can be synthesised. A catalyst is easy to prepare, the reaction conditions are moderate, a substrate is wide in adaptability, and the short-chain dehydrogenase is environment-friendly; and moreover, the recombinant cell of the short-chain dehydrogenase is capable of efficiently catalyzing the asymmetric reduction for prochiral ketones in an isopropanol-containing reaction system without any coenzyme, and has a great industrialized application and development prospect.

Description

[0001] (1) Technical field [0002] The invention belongs to the technical field of biochemical industry, and specifically relates to a short-chain dehydrogenase and its gene, a recombinant expression vector and a recombinant expression transformant containing the gene, and the short-chain dehydrogenase or a recombinant cell containing the enzyme in Application in the synthesis of chiral intermediates of astaxanthin. [0003] (2) Background technology [0004] Astaxanthin (3,3'-dihydroxy-4,4'-diketo-β,β'-carotene) is a new type of carotenoid widely existing in nature. Astaxanthin is one of the strongest natural antioxidants in the world. Its antioxidant capacity is more than 10 times that of other carotenoids and 300-500 times that of vitamin E; it has anti-tumor, anti-radiation, anti-aging, and immune-enhancing properties Therefore, it is widely used in the production of health care products, medicines, cosmetics, food and feed, etc. Astaxanthin mainly has three different is...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/04C12N15/53C12N15/10C12P7/26
CPCC12N9/0006C12P7/26C12Y101/01184
Inventor 于洪巍李爱朋
Owner 杭州馨海酶源生物科技有限公司