Application of OsSAPK9 protein and coding gene thereof in improving resistance to rice bacterial leaf blight

A technology for transgenic rice and leaf blight, which is applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problems of difficulty in using disease-resistant genes and loss of variety resistance

Active Publication Date: 2017-05-10
INST OF CROP SCI CHINESE ACAD OF AGRI SCI +1
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the reported rice bacterial blight resistance genes, due to the difficulty of using the disease resistance genes from wild rice, the resistance of some disease resistance genes is only expressed after the rice adult plant stage, and the resistance of most of the resistance genes For a long time, only a few genes such as Xa3, Xa4, Xa7, Xa21 and Xa23 have been used in production
Rice bacterial blight has complex diversity and high variability. After large-scale promotion and planting of disease-resistant varieties carrying a single main effect gene, potentially toxic races will rise to dominant races or new less toxic races will emerge due to pathogen mutation. Species, varieties rapidly lose resistance, which has long plagued breeders and plant pathologists

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of OsSAPK9 protein and coding gene thereof in improving resistance to rice bacterial leaf blight
  • Application of OsSAPK9 protein and coding gene thereof in improving resistance to rice bacterial leaf blight
  • Application of OsSAPK9 protein and coding gene thereof in improving resistance to rice bacterial leaf blight

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Example 1, OsSAPK9 gene expression analysis

[0065] 1. Sow the 9804 rice seeds in a seedling tray filled with sterilized soil, cultivate them in a greenhouse for 25 days, and then transplant them into a net room for single planting.

[0066] 2. During the tillering stage of the rice plants in step 1, the Xoo strain ZHE173 was used to artificially inoculate the rice plants by the leaf-cutting method, and each plant was inoculated with 5 leaves.

[0067] 3. Complete the 0, 2, 4, 6, 9, 11, 48, 72, 96 h of manual inoculation in step 2, cut the inoculated leaves, and quickly put them in liquid nitrogen for quick freezing, and take three biological replicates for each sample. All samples were quickly frozen in liquid nitrogen and stored at -70°C.

[0068] 4. Take the sample obtained in step 3, extract the total RNA of the sample, and reverse transcribed it into cDNA.

[0069] 5. Using the cDNA obtained in step 4 as a template, perform qRT-PCR reaction, use primer F and primer R to de...

Embodiment 2

[0077] Example 2, OsSAPK9 gene function analysis

[0078] 1. OsSAPK9 gene RNAi vector construction

[0079] 1. Extract total RNA from 9804 rice leaves and reverse transcribed into cDNA.

[0080] 2. Using the cDNA obtained in step 1 as a template, the primer attB-F and the primer attB-R are used for PCR amplification to obtain the amplified product.

[0081] attB-F: 5′- GGGGACAAGTTTGTACAAAAAAGCAGGCTGC CAGGTTGACACACTGCGAA-3′;

[0082] attB-R: 5′- GGGGACCACTTTGTACAAGAAAGCTGGGT AGTGCTTATCCTCAACTTCGC-3'.

[0083] 3. Through the BP reaction, the amplified product obtained in step 2 is introduced into the vector pDONR201 to obtain the positive entry clone plasmid pDONR201-OsSAPK9i containing the double-stranded DNA molecule shown in sequence 3 of the sequence list (verified by sequencing).

[0084] BP reaction system: amplified product 2.7μL (50-100ng), vector pDONR201 1.0μL (30-50ng), 5×BPReaction Buffer 1.0μL, BP Enzyme mix 0.3μL.

[0085] BP reaction conditions: 25℃ warm bath for 1h.

[0086...

Embodiment 3

[0114] Example 3 Application of OsSAPK9 gene in improving rice bacterial blight

[0115] 1. Construction of OsSAPK9 gene overexpression vector

[0116] 1. Extract total RNA from 9804 rice leaves and reverse transcribed into cDNA.

[0117] 2. Using the cDNA obtained in step 1 as a template, use primer attB-F1 and primer attB-R1 for PCR amplification to obtain the amplified product.

[0118] attB-F1: 5′- GGGGACAAGTTTGTACAAAAAAGCAGGCTGC ATGGAGAGGGCGGCGG-3';

[0119] attB-R1: 5′- GGGGACCACTTTGTACAAGAAAGCTGGGT GACATGGCATATACGATCTCTCCG-3'.

[0120] 3. Through the BP reaction, the amplified product obtained in step 2 is introduced into the vector pDONR201 to obtain the positive entry cloning plasmid pDONR201-OsSAPK9 containing the double-stranded DNA molecule shown in sequence 1 of the sequence table.

[0121] BP reaction system: amplified product 2.7μL (50-100ng), vector pDONR201 1.0μL (30-50ng), 5×BPReaction Buffer 1.0μL, BP Enzyme mix 0.3μL.

[0122] BP reaction conditions: 25℃ warm bath fo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of OsSAPK9 protein and a coding gene thereof in improving resistance to rice bacterial leaf blight. The invention provides a method for breeding transgenic rice, wherein the method comprises a step of introducing an OsSAPK9 protein coding gene into initial rice, so as to obtain the transgenic rice that resistance to the bacterial leaf blight is improved, wherein OsSAPK9 protein is constituted by an amino acid sequence shown as sequence 2 in a sequence list; and a gene coding region for coding the OsSAPK9 protein is shown as 1st-1086th amino acids from 5' terminal of sequence 1 in the sequence list. The invention also discloses the application of the OsSAPK9 protein and the coding gene thereof in improving the resistance to the rice bacterial leaf blight. The invention is of great significance for breeding a new rice variety capable of resisting the bacterial leaf blight; and the invention is suitable for popularization and application.

Description

Technical field [0001] The invention relates to an application of OsSAPK9 protein and its coding gene in improving resistance to bacterial blight of rice. Background technique [0002] Bacterial blight, which is caused by Xanthomonas oryzae pv.oryzae (Xoo), is one of the most important bacterial diseases in rice cultivation in the world, and it is seriously harmful in the rice regions of South China and Southeast Asia. Bacterial blight of rice can generally reduce the yield of rice by about 10%, and in severe cases it can reduce the yield by 50%-60%. Utilizing resistance genes and breeding disease-resistant varieties are the most economical and effective measures to control rice bacterial blight. Using methods such as phenotypic identification, genetic analysis, and gene mapping, 40 rice bacterial blight resistance genes have been discovered and reported at home and abroad. However, among the rice bacterial blight resistance genes that have been reported, the resistance genes d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82A01H5/00C12N9/12C12N15/54C12N15/113
CPCC12N9/1205C12N15/1137C12N15/8218C12N15/8281C12N2310/14
Inventor周永力张帆卢家铃黎志康
OwnerINST OF CROP SCI CHINESE ACAD OF AGRI SCI