Escherichia coli fusion expression plectasin, preparation method and application thereof

A Plectasin, fusion expression technology, applied in the application, chemical instruments and methods, expression enhancement stability/folded protein fusion, etc., can solve the problem of high cost, unsuitable for antibacterial drug preparations, health products or preservatives, impact Problems such as the expression of plectasin antimicrobial peptides, to achieve soluble expression and reduce production costs

Active Publication Date: 2017-07-21
WUHU TIANMING BIOTECH CO LTD
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] At present, there have been some researches on the expression of plectasiacin gene engineering at home and abroad, but because the pphaceasin antimicrobial peptide has antibacterial effect, the expression host such as Escherichia coli expresses the plectasiacin antimicrobial peptide will feedback inhibit the activity of host cells , affect the further expression of plectasin antibacterial peptides, so yeast expression is often used in the genetic engineering research of plectasin antimicrobial peptides, or expression in Escherichia coli plus a large fusion protein is performed together to remove the fusion protein tag and purify However, the cost of the two different expression methods is relatively high, and it is not suitable for widespread use in animal feed additives, antibacterial drug preparations, health products or preservatives, so there is no mature plectasin antimicrobial peptide product on the market

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Escherichia coli fusion expression plectasin, preparation method and application thereof
  • Escherichia coli fusion expression plectasin, preparation method and application thereof
  • Escherichia coli fusion expression plectasin, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] The preparation process of embodiment 1 plectasin fusion protein

[0022] (1) Design and synthesis of Plectasin fusion protein gene

[0023] According to the amino acid sequence of Ascomyces saprophyticum Plectasin reported in the published literature (Mygind PH, et al. Nature, 2005; 437(13):975-980) and the amino acid of thioredoxin (Trx) in Genbank Sequence, then refer to the preferred codons of Escherichia coli to design the plectasin fusion protein gene, and use the GGGGS flexible Linker to connect the plectasin and Trx. The designed gene sequence is as follows:

[0024] CATATG AGCGATAAAATTATTCACCTGACTGACGACAGTTTTGACACGGATGTACTCAAAGCGGACGGGGCGATCCTCGTCGATTTCTGGGCAGAGTGGTGCGGTCCGTGCAAAATGATCGCCCCGATTCTGGATGAAATCGCTGACGAATATCAGGGCAAACTGACCGTTGCAAAACTGAACATCGATCAAAACCCTGGCACTGCGCCGAAATATGGCATCCGTGGTATCCCGACTCTGCTGCTGTTCAAAAACGGTGAAGTGGCGGCAACCAAAGTGGGTGCACTGTCTAAAGGTCAGTTGAAAGAGTTCCTCGACGCTAACCTGGCC GGTGGCGGTGGTAGTATGGGCTTTGGCTGTAATGGTCCGTGGGATGAAGATGATA TGCAGTGC...

Embodiment 2

[0031] Antibacterial and bactericidal experiments of embodiment 2 Plectasin fusion protein

[0032] (1) Disk method to detect the antibacterial effect of plectasin fusion protein

[0033] The test strains were clinical methicillin-resistant Staphylococcus aureus MRSA15471114, MRSA15471118 and penicillin-resistant Streptococcus pneumoniae PRSP31355, among which Staphylococcus aureus MRSA15471114 and MRSA15471118 were cultured in M-H medium, and penicillin-resistant Streptococcus pneumoniae PRSP31355 was cultured with 5% Culture sheep blood in M-H medium, cultivate at 37°C until OD600=0.5, take 100 μL of bacterial solution and spread evenly on the agar plate. Place the autoclaved paper evenly on the surface of the agar plate, and add 30 μL of 1 mg / mL plectasin and 10 μL of 1 mg / mL cephalexin dropwise on the paper. Add 30 μL ddH dropwise 2The disk of O was used as a negative control. The results showed that plectasin fusion protein had antibacterial effect on three clinical dr...

Embodiment 3

[0036] Example 3 Acute Toxicity Test of Plectasin Fusion Protein in Mice

[0037] The purpose of this experiment is to observe whether plectasin fusion protein has toxic effects on mice. Forty healthy BALB / c mice, half male and half male, weighing 22±0.31 g, were used. Plectasin fusion protein 1mg / mL, intramuscularly injected 1 time a day, 0.1mL / time, continuously injected for 7 days, and the toxic reaction in mice was observed. The experimental results showed that during the experiment, the mice had no abnormal reaction, their diet and activities were normal, and all 40 mice survived. The mice were killed, and no abnormalities were found in the heart, liver, lung, spleen, kidney, gastrointestinal tract and other organs. It is proved that the plectasin fusion protein has no toxic effect on animals.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fusion expression plectasin, a preparation method and application thereof. The amino acid sequence of the recombinant plectasin is SEQ ID NO:1; and a nucleotide sequence designed according to an escherichia coli preferred codon is SEQ ID NO:2. According to the invention, a prokaryotic expression vector is utilized to construct the escherichia coli BL21 (DE3) host strain capable of expressing plectasin-thioredoxin fusion protein. The strain is subjected to multiplication culture, isopropyl-beta-D-isopropylthiogalactoside induction expression is carried out, centrifugation is performed to harvest thallus, the thallus is cracked, then centrifugation is conducted to acquire the supernatant, and affinity chromatography purification is carried out to obtain plectasin fused protein, the growth of gram positive staphylococcus aureus, streptococcus pneumoniae and the like can be significantly inhibited without removing thioredoxin by enzyme digestion. According to the invention, plectasin fused protein has obvious bacteriostatic effect without removing fusion protein by enzyme digestion, and the production cost is greatly reduced.

Description

Background technique [0001] Antimicrobial peptides are a class of small peptides that widely exist in organisms in nature, and they are an important part of the body's innate immune system. Because antimicrobial peptides have a wide range of inhibitory effects on bacteria, fungi, parasites, viruses, tumor cells, etc., and with the emergence of more and more antibiotic-resistant microorganisms, antimicrobial peptides have good applications in the fields of pharmaceutical industry and food additives. application prospects. Plectasin is a fungal defensin, which belongs to a kind of antimicrobial peptide. The mature functional fragment of Plectasin has 40 amino acids, and its molecular weight is 4.4kD. Its biological activity is mainly manifested as a strong bactericidal effect on Gram-positive bacteria, especially Streptococcus pneumoniae and Streptococcus pyogenes. , Staphylococcus aureus, etc., have antibacterial effects comparable to penicillin and vancomycin. Studies have ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/62C12N15/70C07K19/00A23K20/147A23L33/195A23L3/3535A61K38/16A61K47/64A61P31/04
CPCA23L3/3535A23V2002/00A61K38/00C07K14/37C07K2319/35C12N15/70A23V2200/10A23V2250/546
Inventor赵俊甘霖王明丽
OwnerWUHU TIANMING BIOTECH CO LTD