Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Porcine circovirus type-3 PCR (Polymerase Chain Reaction) detection kit and detection method

A porcine circovirus, detection kit technology, applied in biochemical equipment and methods, determination/inspection of microorganisms, etc.

Inactive Publication Date: 2017-08-22
HEBEI AGRICULTURAL UNIV.
View PDF4 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Aiming at the problem that there is no PCR detection kit and detection method for detecting porcine circovirus type 3 in the prior art, the present invention provides porcine circovirus type 3 PCR detection kit and detection method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Porcine circovirus type-3 PCR (Polymerase Chain Reaction) detection kit and detection method
  • Porcine circovirus type-3 PCR (Polymerase Chain Reaction) detection kit and detection method
  • Porcine circovirus type-3 PCR (Polymerase Chain Reaction) detection kit and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Porcine circovirus type 3 PCR detection kit

[0029] The kit of this example includes:

[0030] (1) Porcine circovirus type 3 DNA extraction reagent: proteinase K, lysate, sodium acetate, saturated phenol, chloroform, isoamyl alcohol, anhydrous ethanol, sterile distilled water;

[0031] (2) PCR reaction reagents: 2×TaqPCR Mix, upstream primer, downstream primer;

[0032] (3) Others: positive control and nuclease-free water; among them, 2 × TaqPCR Mix consists of DNA polymerase, 2 × TaqPCR buffer and dNTP Mixture, and the positive control is inoculation of porcine circovirus type 3 with PK-15, collecting 72~ The supernatant of infected cells for 96 hours, primers are lyophilized powder, HPLC pure. The primer sequences included in the kit of this example are shown in the table below

[0033] primer Sequence (5'-3') Upstream primer (SEQ ID No.1) GAGGCTTTGTCCTGGGTGAG Downstream Primer (SEQ ID No.2) TAAACGAATGGGAAACTGCGAT

Embodiment 2

[0035] Detection of Porcine Circovirus Type 3 by PCR

[0036] The detection method in this example adopts the kit in Example 1. The lymph nodes, spleen, lungs, kidneys and other tissues of the diseased pigs were taken as samples to be tested.

[0037] The detection method includes the following steps:

[0038] 1. The specific steps of viral DNA extraction are as follows:

[0039] (1) After shredding the sample to be tested, add normal saline at a mass-to-volume ratio of 1:5 and grind it evenly, centrifuge at 3000-5000 rpm for 5-10 minutes and then take the supernatant;

[0040] (2) Take 300 μL of the sample to be tested and the positive control after the above treatment, add 10 μL of proteinase K, 300 μL of cell lysate, incubate at 50°C for 2 h, add 610 μL of tris-equilibrium phenol, shake well for 5 min, and centrifuge at 12,000 rpm for 10 min ;

[0041] (3) Transfer the supernatant to a new 1.5mL centrifuge tube, add an equal volume of phenol:chloroform:isoamyl alcohol (...

Embodiment 3

[0048] Sensitivity test of PCR detection method for porcine circovirus type 3

[0049] The concentration of porcine circovirus type 3 DNA was calculated to be 1597 ug / µL by ultra-micro spectrophotometer measurement, with 10 0 -10 -8 Double-diluted viral nucleic acid for sensitivity test.

[0050] The operation process of PCR detection of porcine circovirus type 3 was carried out according to Example 2.

[0051] The PCR amplification products were detected by 1% agarose gel electrophoresis, and the results were as follows figure 2 As shown, PCR can detect at least 0.1597ng / µL porcine circovirus type 3 nucleic acid template.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biologics, and in particular to a porcine circovirus type-3 PCR (Polymerase Chain Reaction) detection kit and a detection method. The porcine circovirus type-3 PCR detection kit contains a DNA (Deoxyribonucleic Acid) extraction reagent, 2*TaqPCR Mix, an upstream primer and a downstream primer; the sequence of the upstream primer is as shown in SEQ ID No.1; and the sequence of the downstream primer is as shown in SEQ ID No.2. By adopting the PCR detection method of the kit, the porcine circovirus type-3 can be rapidly and specifically detected.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a PCR detection kit and a detection method for porcine circovirus type 3. Background technique [0002] Porcine circovirus (PCV) is a single-stranded circular DNA virus with a genome length of about 1.7kb. Two types of PCV have been identified, namely circovirus type 1 (PCV1) and circovirus type 2 ( PCV2). Porcine circovirus type 3 is an emerging infectious disease with a genome length of 2.0kb. It was first reported in the United States in 2016, and the pathogen has also been detected in pigs in my country. Clinical investigations have shown that PCV3 is associated with reproductive disorders in pigs. [0003] Polymerase chain reaction (PCR) is widely used in the field of animal disease detection due to its advantages of good specificity, high sensitivity and good repeatability. At present, there is no PCR detection kit and detection method for the detection of porcin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68
CPCC12Q1/686C12Q1/701
Inventor 袁万哲庞笑语王建昌孙继国董世山
Owner HEBEI AGRICULTURAL UNIV.
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com