Porcine circovirus type-3 PCR (Polymerase Chain Reaction) detection kit and detection method
A porcine circovirus, detection kit technology, applied in biochemical equipment and methods, determination/inspection of microorganisms, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Porcine circovirus type 3 PCR detection kit
[0029] The kit of this example includes:
[0030] (1) Porcine circovirus type 3 DNA extraction reagent: proteinase K, lysate, sodium acetate, saturated phenol, chloroform, isoamyl alcohol, anhydrous ethanol, sterile distilled water;
[0031] (2) PCR reaction reagents: 2×TaqPCR Mix, upstream primer, downstream primer;
[0032] (3) Others: positive control and nuclease-free water; among them, 2 × TaqPCR Mix consists of DNA polymerase, 2 × TaqPCR buffer and dNTP Mixture, and the positive control is inoculation of porcine circovirus type 3 with PK-15, collecting 72~ The supernatant of infected cells for 96 hours, primers are lyophilized powder, HPLC pure. The primer sequences included in the kit of this example are shown in the table below
[0033] primer Sequence (5'-3') Upstream primer (SEQ ID No.1) GAGGCTTTGTCCTGGGTGAG Downstream Primer (SEQ ID No.2) TAAACGAATGGGAAACTGCGAT
Embodiment 2
[0035] Detection of Porcine Circovirus Type 3 by PCR
[0036] The detection method in this example adopts the kit in Example 1. The lymph nodes, spleen, lungs, kidneys and other tissues of the diseased pigs were taken as samples to be tested.
[0037] The detection method includes the following steps:
[0038] 1. The specific steps of viral DNA extraction are as follows:
[0039] (1) After shredding the sample to be tested, add normal saline at a mass-to-volume ratio of 1:5 and grind it evenly, centrifuge at 3000-5000 rpm for 5-10 minutes and then take the supernatant;
[0040] (2) Take 300 μL of the sample to be tested and the positive control after the above treatment, add 10 μL of proteinase K, 300 μL of cell lysate, incubate at 50°C for 2 h, add 610 μL of tris-equilibrium phenol, shake well for 5 min, and centrifuge at 12,000 rpm for 10 min ;
[0041] (3) Transfer the supernatant to a new 1.5mL centrifuge tube, add an equal volume of phenol:chloroform:isoamyl alcohol (...
Embodiment 3
[0048] Sensitivity test of PCR detection method for porcine circovirus type 3
[0049] The concentration of porcine circovirus type 3 DNA was calculated to be 1597 ug / µL by ultra-micro spectrophotometer measurement, with 10 0 -10 -8 Double-diluted viral nucleic acid for sensitivity test.
[0050] The operation process of PCR detection of porcine circovirus type 3 was carried out according to Example 2.
[0051] The PCR amplification products were detected by 1% agarose gel electrophoresis, and the results were as follows figure 2 As shown, PCR can detect at least 0.1597ng / µL porcine circovirus type 3 nucleic acid template.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com