Unlock instant, AI-driven research and patent intelligence for your innovation.

Escherichia coli expressing hydroxytyrosol and hydroxytyrosol glucoside and its construction method and application

A technology of hydroxytyrosol and glucoside, applied in the field of bioengineering, can solve the problems of low yield and yield of glycosylation strains, complex process, unsafety and the like, and achieves easy large-scale fermentation and cultivation, rapid growth and low cost. Effect

Active Publication Date: 2021-02-19
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2009, Seeberger and others studied the chemical method of glycosylation, but this method is greatly affected by the environment, and the production efficiency is low (SeebergerPH, Finney N, Rabuka D, Bertozzi CR.2009.Chemical and Enzymatic Synthesis ofGlycans and Glycoconjugates. ); in 2006, Mao et al. carried out glycosylation reaction in microorganisms through biotransformation, but the yield and yield of glycosylated strains were generally low (Mao Z, Shin HD, ChenRR.2006.Engineering the E.coli UDP-glucose synthesis pathway for oligosaccharide synthesis. Biotechnol Prog 22(2):369–374.); In 2015, Frederik DeBruyn et al. successfully Obtain gallic acid glycosylation product gallic acid glucopyranose (Frederik De Bruyn, Brecht De Paepe, JoMaertens, Joeri Beaupreze. Development of an In Vivo Glucosylation Platform by Coupling Production to Growth: Production of Phenolic Glucosides by aGlycosyltransferase of Vitis Vinifera. Biotechnology and Bioengineering 112:1594-1603.), provides a new idea for the glycosylation process
[0007] To sum up, hydroxytyrosol glucoside compounds are mostly obtained through plant extraction and chemical synthesis, and the direct extraction process from plants is complex and costly; the existence of chemical methods requires selective protection, produces toxic pollutants, and often leaves a small or trace amount. A large amount of other toxic chemicals is unsafe, and the production cost is still high; the yield of the biotransformation method is low, and it is difficult to produce on a large scale
At present, there is no relevant report on the production of hydroxytyrosol glucoside compounds by E. coli using simple carbon sources such as glucose. Therefore, creating a method for E. coli to produce hydroxytyrosol glucoside compounds using simple carbon sources such as glucose has important scientific research value and social benefits

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Escherichia coli expressing hydroxytyrosol and hydroxytyrosol glucoside and its construction method and application
  • Escherichia coli expressing hydroxytyrosol and hydroxytyrosol glucoside and its construction method and application
  • Escherichia coli expressing hydroxytyrosol and hydroxytyrosol glucoside and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Gene UGT73B6 or its mutant UGT73B6 FS For the specific acquisition method, please refer to Chinese patent 201510160497.8.

[0037] pET28a-UGT73B6 FS -P Trc ARO10-P Trc HpaBC construction method:

[0038] NotI and XhoI double restriction plasmid pTrcHisB-P Trc ARO10-P Trc HpaBC, obtained with P Trc Promoter Gene Fragment P Trc ARO10-P Trc HpaBC, and NotI and XhoI double-digested vector pET28a-UGT73B6 FS The fragments were ligated and transformed into E.coli DH5α to obtain the intermediate plasmid pET28a-UGT73B6 FS -P Trc ARO10-P Trc HpaBC.

[0039] Among them, pTrcHisB-P Trc ARO10-P Trc The construction method of HpaBC is consistent with that in Chinese patent 201510242626.8 (a method and application of Escherichia coli to produce hydroxytyrosol using a simple carbon source such as glucose); pET28a-UGT73B6 FS The construction method of pET28a-UGT73B6 is consistent with the literature construction method (Bai Y, Bi H, Zhuang Y, et al. Production of salidros...

Embodiment 2

[0041] Construction method of plasmid pBb0-T7:

[0042] Using Escherichia coli BL21 (DE3) genomic DNA as a template, using primers T7Pol-5FPEcoRI (SEQ ID No: 1) / T7Pol-3RPPstI (SEQ ID No: 2) to amplify the T7 polymerase gene fragment, EcoRI and PstI double enzyme T7 polymerization The enzyme gene fragment and the expression vector pBb0 were transformed into E. coli DH5α to obtain the vector pBb0-T7. Among them, the construction method of pBb0 is consistent with that reported in the literature (Bai Y, Bi H, Zhuang Y, et al. Production of salidroside in metabolically engineered Escherichia coli [J]. Scientific reports, 2014, 4: 6640-6647.).

[0043] SEQ ID No: 1 Sequence: CCGGAATTCATGAACACGATTAACATCGCTAAG

[0044] SEQ ID No: 2 Sequence: GTTCTGCAGTTACGCGAACGCGAAGTCCGACTC

[0045] In the above steps, the reaction program of the PCR amplification reaction can be a conventional PCR amplification reaction program, for example, it can be: 94-95°C pre-denaturation for 4-5 minutes; 96-...

Embodiment 3

[0047] Plasmid pET28a-UGT73B6 FS -P Trc ARO10-P Trc HpaBC-P lacUV5 The construction method of T7:

[0048] Using pBb0-T7 as a template, PCR amplification with P lacUV5 Promoter of the T7 polymerase gene. The PCR primers are T7-5FP-XhoI, whose sequence is shown in SEQ ID No: 3, and T7-3RP-XhoI, whose sequence is shown in SEQ ID No: 4. Use XhoI to single-enzyme digest with P lacUV5 Promoter of T7 polymerase gene and vector pET28a-UGT73B6 FS -P Trc ARO10-P Trc HpaBC, and transformed into E.coli DH5α, the final expression vector pET28a-UGT73B6 was obtained FS -P Trc ARO10-P Trc HpaBC-P lacUV5 T7.

[0049] SEQ ID No: 3 Sequence: CCGCTCGAGTTTACACTTTATGCTTCCG

[0050] SEQ ID No: 4 Sequence: CCGCTCGAGTTACGCGAACGCGAAGTCC

[0051] In the above steps, the reaction procedure of the PCR amplification reaction is the same as in Example 2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an Escherichia coli expressing hydroxytyrosol and hydroxytyrosol glucoside, its construction method and application, an Escherichia coli expressing hydroxytyrosol and hydroxytyrosol glucoside, the Escherichia coli contains and can express ARO10, HpaBC and UGT Gene. The recombinant Escherichia coli tyrosine pathway-related genes of the present invention are overexpressed, which can significantly increase the levels of hydroxytyrosol, hydroxytyrosol-3-O-β-D-glucoside and hydroxytyrosol-4-O-β-D ‑glucoside output, wherein the output of hydroxytyrosol can reach 401mg / L, the output of hydroxytyrosol‑3‑O‑β‑D‑glucoside can reach 406mg / L, and the output of hydroxytyrosol‑4‑O‑β‑D The output of ‑glucoside can reach 928mg / L, laying the foundation for its large-scale industrial production application.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to an Escherichia coli expressing hydroxytyrosol and hydroxytyrosol glucoside, a construction method and application thereof. Background technique [0002] Hydroxytyrosol, Chinese alias: 3,4-dihydroxyphenethyl alcohol. Molecular formula: C 8 h 10 o 3 . Structural formula: Molecular weight: 154.1632. Hydroxytyrosol-3-O-β-D-glucoside (Hydroxytyrosol-3-O-β-D-glycoside), molecular formula: C 14 h 20 o 8 , the structural formula: Molecular weight: 316.31. Hydroxytyrosol-4-O-β-D-glucoside (Hydroxytyrosol-4-O-β-D-glycoside), molecular formula: C 14 h 20 o 8 , the structural formula: Molecular weight: 316.31. [0003] Hydroxytyrosol is a natural polyphenol compound with fat solubility, water solubility and biological activity. It mainly exists in various parts of olives in the form of esterified oleuropein. After hydrolysis, oleuropein can be obtained as...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N15/70C12N15/60C12N15/53C12N15/54C12P7/22C12P19/44C12R1/19
CPCC12N9/0004C12N9/10C12N9/88C12P7/22C12P19/44
Inventor 刘涛殷华庄以彬李晓林毕慧萍马延和
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI