A production method and applications of a novel rhizomucor miehei aspartic protease

A technology of aspartic acid and protease, applied in the direction of biochemical equipment and methods, applications, protein food processing, etc., can solve the problem of few reports on the application of protease genes and proteases

Active Publication Date: 2017-11-10
CHINA AGRI UNIV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the genome of Rhizomucor miehei has been reported to contain multiple protease genes, there are few reports on the cloning and expression of protease genes and other applications of protease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A production method and applications of a novel rhizomucor miehei aspartic protease
  • A production method and applications of a novel rhizomucor miehei aspartic protease
  • A production method and applications of a novel rhizomucor miehei aspartic protease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1: Construction and identification of recombinant strains

[0047] The RNA of Rhizomucor miehei was extracted, reverse transcribed into cDNA, cDNA was used as a template, primers were designed, and the RmproA gene was obtained by PCR and cloned into the expression vector pPIC9K to obtain the recombinant plasmid pPIC9K-RmproA, which was transformed into Pichiapastoris GS115. Identify and obtain recombinant strains. The transformation of Pichia pastoris adopts electrotransformation method, spreads on MD plates, cultures for 3-4 days, picks out single clones for next step screening.

[0048] The primers are as follows:

[0049] Upstream: CCGGAATTCCTCCCTGTCACTAATGTTTCCCAG

[0050] Downstream: GCGGCCGCTTACATGTTAAGAGCTGCCGCGGAC

[0051] Experimental results: After comparing with the protein sequence, the protease and the reported Mucor chymosin derived from Rhizopus miehei (Mucorpepsin, P00799.1) (Yang J., Teplyakov A., &Quail JWCrystal structure of the aspartic proteinase) ...

Embodiment 2

[0052] Example 2: Fermentation and cultivation of recombinant aspartic protease in a 5L fermentor

[0053] Pick a single colony from the solid medium plate and inoculate it in YPD medium (50 mL in a 500 mL Erlenmeyer flask), cultivate it at 30°C and 220 rpm for 24 hours as the seed solution, and then inoculate the 1.5L batch fermentation with 10% inoculum Medium (CaSO 4 0.93g, K 2 SO 4 18.2g, MgSO 4 ·7H 2 O 14.9g, KOH 4.13g, glycerol 40g, 85% phosphoric acid 26.7mL, PTM 1 4.35mL / L) 5L fermentor, the initial stirring speed is 600 rpm, the aeration is 1.0vvm, 25% ammonia water adjusts pH 5.0, the culture temperature is 30℃, when the glycerin is exhausted and the dissolved oxygen rebounds, it will be fed by flow 50% glycerol (w / v, containing 12mL / LPTM 1 ), when the glycerol is depleted again and the dissolved oxygen rebounds, hungry for 1 h, and then fed with induction medium (100% methanol containing 12mL / LPTM 1 ), the stirring speed is increased to 800rpm to induce protease expr...

Embodiment 3

[0059] Example 3: Purification and enzymatic properties of recombinant aspartic protease

[0060] 1. Purification of recombinant aspartic protease

[0061] 1. Cultivation of recombinant aspartic protease in fermenter

[0062] The same as in Example 2. The fermentation broth was frozen and centrifuged at 10,000×g for 10 min, and the supernatant (crude enzyme solution) was taken.

[0063] 2. Ion exchange chromatography

[0064] (1) The supernatant obtained in step 1 was subjected to QSFF strong anion exchange chromatography at a flow rate of 0.1 mL / min, and 10 column volumes were eluted with a linear gradient of 0-500 mM NaCl aqueous solution to collect the active components with protease enzymes. The enzyme activity determination conditions are the same as in Example 2.

[0065] (2) The solution collected in step (1) through the column is subjected to ultrafiltration treatment (filter membrane selection can cut off proteins with molecular weight above 10kDa), collect protein macromolecu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a production method and applications of a novel rhizomucor miehei aspartic protease, and particularly relates to a recombinant aspartic protease, a coding gene, and a production method and applications of the recombinant aspartic protease. The recombinant aspartic protease is protein having an amino acid sequence shown as SEQ ID NO:1. The coding gene of the recombinant aspartic protease is a DNA molecule shown as SEQ ID NO:2. An aspartic protease gene that is RmproA of rhizomucor miehei is connected to a pichia pastoris GS115 expression vector pPIC9K, and is converted into pichia pastoris and induced expression is performed to obtain the recombinant aspartic protease. Through high-density fermentation in a fermentation tank having a volume of 5 L, the maximum protease production activity at 156 h of a recombinant strain is 3400 U / mL, and the protein content is 6.42 mg / mL. The recombinant aspartic protease is capable of effectively tendering pork, reducing shearing force, making meat palatable, and effectively hydrolyzing animal and plant protein to prepare low-molecular-weight polypeptides.

Description

Technical field [0001] The invention relates to a production method and application of a novel Rhizomucor miehei aspartic protease. Background technique [0002] Protease (EC 3.4) is a class of enzymes that catalyze the hydrolysis of proteins to produce polypeptides and amino acids, and play different physiological functions in organisms. There are abundant sources of proteases, which are widely found in animals, plants and microorganisms. The proteases obtained through natural screening and genetic engineering have different characteristics and have been used in many fields such as food, tanning, feed and washing. [0003] Aspartic proteases are a class of proteases with important industrial application value, which are used in cheese manufacturing, seasoning production, casein hydrolysate preparation, meat tenderization and polypeptide preparation. Most aspartic proteases exhibit high activity under acidic pH conditions and are also called acid proteases. The main strains repo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/58C12N15/57C12N15/81A23J3/34A23L13/70
CPCA23J3/341A23J3/346A23L13/74C12N9/58C12N15/815C12Y304/23
Inventor江正强闫巧娟孙倩耿芳龚思怡
OwnerCHINA AGRI UNIV