Ustilaginoidea virens spore real-time quantification loop-mediated isothermal amplication detection method and kit

A technology of ring-mediated isothermal and rice smut bacteria, applied in the direction of microbial determination/testing, microbial-based methods, biochemical equipment and methods, etc., can solve the problems of complex processing process, difficult prevention and control, and low detection sensitivity. Achieve the effect of optimized reaction temperature, high specificity and high sensitivity

Inactive Publication Date: 2017-12-29
ZHEJIANG FORESTRY UNIVERSITY
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Rice false smut is one of the most difficult pests of rice to control at present. The main reason is that it is difficult to grasp its infection dynamics in a timely and rapid manner with existing technologies.
This leads to many agents having high inhibitory activity against rice smut, but the effect is not good in actual application
The main reason is that due to the lack of sensitive and fast bacteria monitoring technology, it is impossible to achieve scientific drug use and scientific prevention
At present, although the number of overwintering chlamydospores in the soil can be checked by artificial isolation culture and conventional microscope observation; however, there are many kinds of microorganisms in the paddy field, and the growth rate of rice mistletoe is slow, and the hyphae and conidia produced by the germination of chlamydospores Without specific morphological characteristics, it is difficult to identify by pathological means such as microscope observation and isolation culture, and it is impossible to understand the changes in the number of rice false smut bacteria in the field during the rice growth season, the infection of plants and their proliferation in plants. These monitoring techniques It takes more than a week
[0004] With the continuous development of nucleic acid-related identification methods, the method based on common PCR has been successfully used for the detection of pathogenic bacteria, but the specificity of the PCR method takes a long time, requiring 6-8 hours, and the reaction is easily affected by PCR inhibitors. The pre-processing process is complicated
At the same time, the PCR method requires an expensive instrument PCR machine, and the detection sensitivity is low, and the detection process is complicated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ustilaginoidea virens spore real-time quantification loop-mediated isothermal amplication detection method and kit
  • Ustilaginoidea virens spore real-time quantification loop-mediated isothermal amplication detection method and kit
  • Ustilaginoidea virens spore real-time quantification loop-mediated isothermal amplication detection method and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] Embodiment 1, the specificity analysis of primer

[0070] Ustilaginoidea virens was used as a positive control, Fusarium fujikurio, Fusarium graminearum, Penicilliu sp., Pyricularia grisea, Alternaria Alternaria alternate and Rhizoctonia solani were used as negative controls, and double distilled water was used as blank control for testing.

[0071] Use a 20 μL reaction system, which is composed of the following components: 8U / μL Bst DNA polymerase 0.5 μL (4U), 10×ThermoPol Buffer 2.5 μL, 20 μM FIP 2.0 μL, 20 μM BIP 2.0 μL, 10 μM F3 0.5 μL, 10 μM B30 .5 μL, 25 mM MgCl 2Add 4.0 μL, 2.5 μL of 10 mM dNTPs, 3.0 μL of 5M betaine, 1 μL of 10×SYBR Green I, add 1 μL of DNA solution as a template, and make up to 20 μL with double distilled water.

[0072] Experiments were performed with the following primer combinations:

[0073] Upstream outer primer (F3): 5'—CGGCCCTTATACCCCATTC—3';

[0074] Downstream outer primer (B3): 5'—GAGGATCTTCAAGCACCTTGG—3';

[0075] Upstream inner...

Embodiment 2

[0099] Embodiment 2, the sensitivity detection of primer

[0100] The DNA of the rice smut fungus (Ustilaginoidea virens) genome was extracted, and the concentration of the DNA solution was measured to be 200 ng / μL by an ultraviolet spectrophotometer. Dilute the DNA solution into 7 concentrations (10ng / μL~1ng / μL) according to a 10-fold gradient. 10ng / μL, 100ng / μL. Configure the following 20μL reaction system: 8U / μL Bst DNA polymerase 0.5μL (4U), 10×ThermoPol Buffer 2.5μL, 20μM FIP 2.0μL, 20μM BIP 2.0μL, 10μM F3 0.5μL, 10μM B3 0.5μL, 25mM MgCl 2 4.0 μL, 2.5 μL of 10 mM dNTPs, 3.0 μL of 5M betaine, 1 μL of 10×SYBR Green I, 1 μL of DNA templates of the above-mentioned concentration gradients (1 μL of double-distilled water was used as blank control), and finally made up to 20 μL with double-distilled water. Experiments were performed with primer combination UV-2. The q-LAMP amplification reaction program was: 64°C, 1min, 60 cycles; 80°C, 10min.

[0101] After the reaction i...

Embodiment 3

[0103] Embodiment 3, the q-LAMP detection of rice false smut fungus spore DNA

[0104] Extraction of the genome of the spore suspension: dilute the spores of the rice smut with 10% SDS to obtain 1.0×10 4 , 2.0×10 3 , 4×10 2 , 8×10 1 , 1.6×10 1 , 3.2×10 0 , 5.4×10 -1 per ml spore suspension. Put 1ml of spore suspension into 2.0ml centrifuge tube, add 0.4g pickled beads, place in Fsat-prep instrument, rotate at 6m / s for 40s, repeat three times, place on ice for 2min. Take 1 μl of the cooled lysate directly as a DNA template for LAMP detection. Experiments were performed with the following primer combinations:

[0105] Upstream outer primer (F3-1): 5'—CGGCCCTTATACCCCATTC—3';

[0106] Downstream outer primer (B3-1): 5'—GAGGATCTTCAAGCACCTTGG—3';

[0107] Upstream inner primer (FIP): 5'—TCTACCCCGCAACTCAGCCCGCGGTTCGTCCGTTTTCG—3';

[0108] Downstream internal primer (BIP): 5'—AGGAGGGGAACTGACACAGGGATTGGCCATGCGTCCATC—3'.

[0109] A 20 μL reaction system was prepared by propo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a LAMP-specific primer composition used in a q-LAMP rapid detection method for rice smut spores. The LAMP-specific primer composition is composed of four primers: upstream and downstream outer primers and upstream and downstream inner primers. The present invention also discloses a loop-mediated isothermal amplification kit for the quantitative detection of rice smut spores, which comprises the above-mentioned LAMP-specific primer composition, and also contains betaine, 10×SYBR Green I, 8U / μL Bst DNA polymerase, etc. The invention also correspondingly discloses a loop-mediated isothermal amplification method for quantitatively detecting the spores of the rice false smut fungus.

Description

technical field [0001] The invention relates to a real-time quantitative loop-mediated isothermal amplification (q-LAMP) detection method and kit for rice false smut, belonging to the technical field of early warning of plant disease detection, identification and prevention. Background technique [0002] Rice false smut is a worldwide rice disease caused by Ustilaginoidea virens (Cooke) Tak., which is seriously harmful in China, Japan, India and other countries. The disease is an ear disease, and white rice balls are formed on the ears at the beginning, and then quickly turn into yellow or dark green rice balls. The disease significantly affects rice yield and rice quality, and the annual yield loss rate is 30-50% in severe cases, and the processed rice is mixed with a large number of chlamydospores. Chlamydospores of rice koji fungus contain the mycotoxin Ustilaxin. The results of animal toxicity experiments by Japanese researchers showed that chlamydospore water extract ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12Q1/04C12R1/645
CPCC12Q1/6895C12Q1/6844
Inventor 张传清张书亚李玲祝倩菲朱国念
Owner ZHEJIANG FORESTRY UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products