Preparation method and application of non-natural ginsenoside

A ginsenoside, non-natural technology, applied in the fields of biotechnology and botany, can solve problems such as high price

Active Publication Date: 2018-04-20
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Although the glycosylation reaction catalyzed by glycosyltransferases has the characteristics of high catalytic efficiency, strong regio- and stereoselectivity, and good substrate tolerance, the glycosylation of substrates catalyzed by glycosyltransferases requires the use of expensive UDP - Glucose as a glycosyl donor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of non-natural ginsenoside
  • Preparation method and application of non-natural ginsenoside
  • Preparation method and application of non-natural ginsenoside

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] Cloning, expression and purification of embodiment 1 glycosyltransferase and sucrose synthase

[0070] The glycosyltransferase in the patent of the present invention is screened from Bacillus subtilis 168, the amino acid sequence is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.7.

[0071] The nucleic acid sequence of said SEQ ID NO.7 is as follows:

[0072] ATGAAAAAGTACCATATTTCGATGATCAATATCCCGGCGTACGGACATGTCAATCCTACGCTTGCTTTAGTAGAGAAGCTTTGTGAGAAAGGGCACCGTGTCACGTACGCGACGACTGAGGAGTTTGCGCCCGCTGTTCAGCAAGCCGGTGGAGAAGCATTGATCTATCATACATCCTTGAATATTGATCCTAAGCAAATCAGGGAGATGATGGAAAAGAATGACGCGCCCCTCAGCCTTTTGAAAGAATCACTCAGCATTCTGCCGCAGCTTGAGGAGTTATATAAGGATGATCAGCCTGATCTGATCATCTATGACTTTGTTGCGCTGGCTGGTAAATTGTTTGCTGAAAAGCTTAATGTTCCGGTCATTAAGCTCTGTTCGTCATATGCCCAAAATG AATCCTTTCAGTTAGGAAATGAAGACATGCTGAAAAAAATAAGAGAAGCAGAGGCTGAATTTAAAGCCTACTTGGAGCAAGAGAAGTTGCCGGCTGTTTCATTTGAACAGTTAGCTGTGCCGGAAGCATTAAATATTGTCTTTATGCCGAAGTCTTTTCAGATTCAGCATGAGACGTTCGATGACCGTTTCTGTTTT...

Embodiment 2

[0085] Example 2 Coupling of glycosyltransferase Bs-YjiC and sucrose synthase AtSuSy to catalyze the synthesis of ginsenosides Rh2 and F12 from protopanaxadiol

[0086] Using protopanaxadiol (PPD) as the substrate and cheap sucrose as the glycosyl donor, it can catalyze the C3-OH and C12-OH glycosylation of PPD through the coupling reaction of glycosyltransferase-sucrose synthase Ginsenoside Rh2 (3-O-β-D-glucopyranosyl-20(S)-protopanaxadiol) and unnatural ginsenoside F12 (3-O-β-D-glucopyranosy-12-β-D-glucopyranosyl-protopanaxadiol), specifically react as figure 2 As shown, the details are as follows:

[0087]

[0088] The enzyme reaction system includes: 2mM protopanaxadiol (PPD), 0.5mM UDP, 300mM sucrose, 160mU / mL glycosyltransferase Bs-YjiC and 200mU / mL sucrose synthase AtSuSy, react at 35°C for 0.5h. The enzyme reaction product was identified by high performance liquid chromatography-electrospray ionization mass spectrometry (HPLC-ESI-MS), and the results were as foll...

Embodiment 3

[0091] Example 3 Feed-batch Synthesis of Ginsenoside Rh2 and F12

[0092] In view of the fact that the coupling reaction of glycosyltransferase Bs-YjiC and sucrose synthase AtSuSy can glycosylate 2mM protopanaxadiol into ginsenoside Rh2 and non-natural ginsenoside F12 within 0.5h, so further batch feeding, That is, protopanaxadiol was supplemented with 2mM every 2h to further explore the potential of the glycosylation method to catalyze the synthesis of ginsenosides Rh2 and F12 from protopanaxadiol. The results are as follows: image 3 shown.

[0093] From Figure 4 It can be seen that through 4 batches of supplementing protopanaxadiol substrates, about 8 hours, 1.6mM ginsenoside Rh2 (1.0g / L) and 8.3mM ginsenoside F12 (6.5g / L) can be obtained finally. The synthesis rates of Rh2 and F12 exceeded 0.125g / L / h and 0.8g / L / h. At present, Saccharomyces cerevisiae engineering bacteria can only produce 15-300mg / L ginsenosides after 7 days of fermentation, which is far lower than the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a preparation method and application of non-natural ginsenoside, specifically to an antitumor drug containing the non-natural ginsenoside F12 (3-O-beta-D-glucopyranosyl-12-O-beta-D-glucopyranosyl-20(S)-protopanaxadiol). The antitumor drug of the invention has significant inhibitory effect on colon cancer cells, liver cancer cells, lung cancer cells and gastric cancer cells. According to the invention, cheap sucrose is used as a glucose glycosyl donor, glycosyltransferase and sucrose synthase are used as coupled catalysts, and protopanaxadiol (PPD) is used as a glycosylacceptor so as to realize high-efficiency catalysis of glycosylation of hydroxyl groups at the position C3 and the position C12 of protopanaxadiol for production of the non-natural ginsenoside F12; and the method has the characteristics of wide sources of a substrate, good specificity of reactions, high catalysis efficiency, simple purification of the non-natural ginsenoside, etc.

Description

technical field [0001] The invention belongs to the technical fields of biotechnology and botany, and relates to a preparation method of unnatural ginsenoside F12 (3-O-β-D-glucopyranosyl-12-O-β-D-glucopyranosyl-20(S)-protopanaxadiol) And application, specifically relate to a kind of antineoplastic drug that comprises unnatural ginsenoside F12. Background technique [0002] Ginseng (Panax ginseng C.A.Mayer) is a perennial herbal medicinal plant of the Araliaceae plant Panax genus, mainly distributed in my country and East Asian countries such as Japan, South Korea, and North Korea; among them, my country's ginseng production ranks first in the world. Ginseng has various physiological effects such as anti-aging, anti-cancer, anti-tumor, improving immunity, anti-radiation and anti-oxidation, and has the reputation of "the king of herbs". [0003] Ginsenoside is the main active substance of ginseng, which is a glycoside compound composed of aglycone and different sugar groups. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K31/704A61P35/00C12P33/20C07J17/00
CPCA61K31/704C12N9/1048C12N9/1062C12P33/20C12Y204/01013C07J17/005
Inventor孙媛霞戴隆海张学礼戴住波李娇
OwnerTIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI