Application of a Cucumber Calcium Binding Protein Gene cscam in Improving Heat Tolerance of Plants
A technology of calcium-binding protein and heat resistance, applied in the fields of application, plant peptides, plant products, etc., can solve the problems of not many, poor development of flower organs, weak plant growth, etc., and achieve the effect of improving heat resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1 Acquisition and expression analysis of cucumber calcium-binding protein gene CsCaM
[0045] 1. Gene sequence analysis of cucumber calcium-binding protein gene CsCaM
[0046] (1) Using the genomic DNA of the cucumber inbred line "02-8" as a template, PCR amplification was performed using upstream and downstream primers:
[0047] Upstream primer: ATGGCGGATCAGCTCACCGA;
[0048] Downstream primer: CCTTAGCCATCATGACCTTAAC;
[0049] PCR reaction system: 1 cycle at 94°C for 3min; 94°C for 1min, 55°C for 45s, 72°C for 90s, a total of 35 cycles; 72°C extension for 7min, and the PCR product was stored at 4°C.
[0050] Specific fragments were amplified from the cucumber genome, connected to the expression vector, and transformed into competent Escherichia coli DH5α to obtain positive recombinant bacteria for sequencing.
[0051] (2) After sequencing, the reading frame of the gene is 450bp, as shown in SEQ ID NO: 1, encoding 149 amino acids, as shown in SEQ ID NO: 2. A...
Embodiment 2
[0072] Example 2 Acquisition of overexpression strains of cucumber calcium-binding protein gene CsCaM
[0073] 1. Construction of expression vector
[0074] The positive recombinant bacterium obtained in the above step is used as a template to carry out PCR to amplify the CsCaM gene, and the specific primers used are:
[0075] P1: 5′- CTCTAGA ATGGCGGATCAGCTCACCGA-3′;
[0076] P2: 5′-C GGATCC CCTTAGCCATCATGACCTTAAC-3';
[0077] The underlined part is the restriction site of XbaI and BamHI. The pBI121 vector was double-digested with XbaI and BamHI, electrophoresis, and a large fragment was recovered. The CsCaM gene PCR product was also double-digested with XbaI and BamHI, and the fragment was recovered. Then, the CsCaM fragment was mixed with pBI121 and ligated with T4 ligase. The ligation product was transformed into Escherichia coli, the recombinants were screened, the plasmid pBI-CsCaM was extracted, and the pBI-CsCaM was transformed into Agrobacterium for transforming...
Embodiment 3
[0081] Example 3 Overexpression of CsCaM in cucumber improves heat tolerance of cucumber
[0082] 1. Heat tolerance identification of transgenic plants
[0083] (1) After the transgenic plants were selfed, T1 transformed plants were obtained, and the T1 generation plants of three transgenic lines (OE-1, OE-2, and OE-3) were selected for heat tolerance identification.
[0084] (2) The results showed that after 5 days of high temperature treatment at 43°C, the mortality rate of non-transgenic plants was more than 30%, while the mortality rate of transgenic plants was less than 5%. After 10 days of high temperature treatment, all non-transgenic plants died, while the survival rate of transgenic plants was still over 60% ( Image 6middle A and B); under high temperature treatment, the radicle length of seeds of transgenic plants was longer than that of non-transgenic plants (see Image 6 Middle C), showing that overexpression of CsCaM gene can improve the heat tolerance of cucum...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap