A kind of organic solvent-resistant high-efficiency galactosidase and its application
A galactosidase and organic solvent-resistant technology, applied in the field of biopharmaceuticals, can solve the problems of easy inactivation of glycosidase and low galactosidase, and achieve the effects of high purity, high space-time yield and few by-products
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] This example illustrates the organic solvent-resistant high-efficiency galactosidase of the present invention gal Isolation and Cloning Procedures for Encoding Genes, Galactosidases of the Invention gal Coding genes from Serratia strains ( Serratia marcescens ) extracted from the total DNA of MH6, the MH6 strain has the deposit number CCTCC NO: M208205, which has been disclosed in the applicant's previous application CN101586086B.
[0026] Total bacterial DNA was extracted by phenol-chloroform method. Through the analysis of the whole genome sequence, Vector NTI software analyzes and aligns to determine the conserved region, obtains a gene encoding galactosidase, and designs primers SF and SR according to the nucleotide sequence of the gene.
[0027] SF (SEQ ID NO:3) sequence is: CGC CATATG CGAGAAAATTATTATGAAC
[0028] SR (SEQ ID NO:4) sequence is: GCG AAGCTT TTATTTCATCTCCAAACGAC
[0029] Among them, the underlined part of primer SF is Nde Ⅰ Restriction sit...
Embodiment 2
[0031] This example illustrates the preparation of recombinant expression vectors and recombinant expression transformants.
[0032] The galactosidase gene fragment obtained in Example 1 was treated with restriction endonuclease at 37°C Hind Ⅲ and NheⅠ were double digested for 3 h, purified by agarose gel electrophoresis, and the target fragment was recovered by agarose gel DNA recovery kit. Under the action of T4 DNA ligase, the target fragment was treated with the same Hind The plasmid pET28a digested by III and NheI was ligated at 16 °C overnight to obtain the recombinant expression plasmid pET- gal .
[0033] The above recombinant expression plasmids were transformed into Escherichia coli ( E.coli ) In the BL21(DE3) competent cells, the positive recombinants were screened on the resistance plate containing kanamycin, single clones were selected, and the positive clones were verified by colony PCR, that is, the positive recombinant transformants Escherichia coli ( ...
Embodiment 3
[0035] This example illustrates recombinant galactosidase gal Induced expression and purification process.
[0036] The recombinant E-pET- gal Inoculated into LB / Kana liquid medium for overnight culture, inoculated into fresh medium at 2% (v / v) inoculum, and when cultured to OD600 to 0.6-0.8, add inducer 0.5 mM isopropylthio- β-D-galactoside (IPTG), 37℃, 180 r min -1 Expression was induced for 4 h. The fermentation broth after induction was at 4°C, 8000 r min -1 The cells were centrifuged for 10 min under conditions, and the cells were washed with an equal volume of buffer (50 mM Na 2 HPO 4 -KH 2 PO 4 , pH 7.0) and suspended, washed twice with normal saline, and then resuspended the cells with PBS buffer pH 7.5-8.5 to obtain the resting cell fluid and sonicated in an ice bath (300 W; ultrasonic for 3 s, intermittent for 5 s, total time 5 min), 4°C, 12000 r min -1 Cell debris was removed by centrifugation for 15 min to obtain the crude enzyme solution of recombinant...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



