Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of organic solvent-resistant high-efficiency galactosidase and its application

A galactosidase and organic solvent-resistant technology, applied in the field of biopharmaceuticals, can solve the problems of easy inactivation of glycosidase and low galactosidase, and achieve the effects of high purity, high space-time yield and few by-products

Active Publication Date: 2022-07-29
NANJING TECH UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Aiming at the problems of low yield of galactosidase limited by thermodynamic equilibrium and easy inactivation of glycosidase in organic phase, the present invention provides a galactoside with high tolerance to organic solvents, good stability and high synthesis efficiency. The enzyme contains a recombinant expression vector encoding the galactosidase gene, a recombinant expression transformant and a high-efficiency preparation method thereof, and a non-aqueous phase reaction system with the addition of a hydrophilic organic solvent is used for the preparation of new salidroside analogues. synthesis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of organic solvent-resistant high-efficiency galactosidase and its application
  • A kind of organic solvent-resistant high-efficiency galactosidase and its application
  • A kind of organic solvent-resistant high-efficiency galactosidase and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] This example illustrates the organic solvent-resistant high-efficiency galactosidase of the present invention gal Isolation and Cloning Procedures for Encoding Genes, Galactosidases of the Invention gal Coding genes from Serratia strains ( Serratia marcescens ) extracted from the total DNA of MH6, the MH6 strain has the deposit number CCTCC NO: M208205, which has been disclosed in the applicant's previous application CN101586086B.

[0026] Total bacterial DNA was extracted by phenol-chloroform method. Through the analysis of the whole genome sequence, Vector NTI software analyzes and aligns to determine the conserved region, obtains a gene encoding galactosidase, and designs primers SF and SR according to the nucleotide sequence of the gene.

[0027] SF (SEQ ID NO:3) sequence is: CGC CATATG CGAGAAAATTATTATGAAC

[0028] SR (SEQ ID NO:4) sequence is: GCG AAGCTT TTATTTCATCTCCAAACGAC

[0029] Among them, the underlined part of primer SF is Nde Ⅰ Restriction sit...

Embodiment 2

[0031] This example illustrates the preparation of recombinant expression vectors and recombinant expression transformants.

[0032] The galactosidase gene fragment obtained in Example 1 was treated with restriction endonuclease at 37°C Hind Ⅲ and NheⅠ were double digested for 3 h, purified by agarose gel electrophoresis, and the target fragment was recovered by agarose gel DNA recovery kit. Under the action of T4 DNA ligase, the target fragment was treated with the same Hind The plasmid pET28a digested by III and NheI was ligated at 16 °C overnight to obtain the recombinant expression plasmid pET- gal .

[0033] The above recombinant expression plasmids were transformed into Escherichia coli ( E.coli ) In the BL21(DE3) competent cells, the positive recombinants were screened on the resistance plate containing kanamycin, single clones were selected, and the positive clones were verified by colony PCR, that is, the positive recombinant transformants Escherichia coli ( ...

Embodiment 3

[0035] This example illustrates recombinant galactosidase gal Induced expression and purification process.

[0036] The recombinant E-pET- gal Inoculated into LB / Kana liquid medium for overnight culture, inoculated into fresh medium at 2% (v / v) inoculum, and when cultured to OD600 to 0.6-0.8, add inducer 0.5 mM isopropylthio- β-D-galactoside (IPTG), 37℃, 180 r min -1 Expression was induced for 4 h. The fermentation broth after induction was at 4°C, 8000 r min -1 The cells were centrifuged for 10 min under conditions, and the cells were washed with an equal volume of buffer (50 mM Na 2 HPO 4 -KH 2 PO 4 , pH 7.0) and suspended, washed twice with normal saline, and then resuspended the cells with PBS buffer pH 7.5-8.5 to obtain the resting cell fluid and sonicated in an ice bath (300 W; ultrasonic for 3 s, intermittent for 5 s, total time 5 min), 4°C, 12000 r min -1 Cell debris was removed by centrifugation for 15 min to obtain the crude enzyme solution of recombinant...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an organic solvent-resistant high-efficiency galactosidase and its application. The galactosidase of the present invention has the amino acid sequence shown in SEQ ID NO: 2, and the gene encoding the galactosidase has the nucleotide sequence shown in SEQ ID NO: 1. The present invention also provides the recombinant expression vector or recombinant bacteria of the galactosidase. The application of the galactosidase in the biocatalytic transglycosylation reaction to synthesize novel salidroside is to establish a non-aqueous phase system for efficiently synthesizing glycoside compounds through the regulation of the biocatalytic transglycosylation reaction in the non-aqueous phase , realizes the efficient preparation of galactoside products of various compounds such as tyrosol, p-hydroxybenzyl alcohol, salicyl alcohol, cinnamyl alcohol, etc. The reaction system is simple, the product conversion rate is high, easy to purify, and the cost is greatly reduced. It has good industrial application value.

Description

technical field [0001] The invention relates to the technical field of biopharmaceuticals, in particular to an organic solvent-resistant high-efficiency galactosidase and its application in non-aqueous phase reaction to synthesize novel salidroside analogs. Background technique [0002] Salidroside is a natural glycoside compound, which is the Rhodiola rosea ), which has many pharmacological effects such as improving immunity, anti-tumor, hypoglycemic, anti-aging, anti-fatigue, hypoxia resistance, and anti-radiation. It has a positive nourishing and health care effect for workers in high radiation environments, mental workers, and middle-aged and elderly people; it is a health care drug for astronauts, pilots, mountaineers, and divers to improve their ability to survive in harsh environments. Oxygen medicine is a kind of environment-adaptive medicine with great development and application prospects. In recent years, due to its unique anti-aging effect, it has been widely u...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/24C12N15/56C12P19/44
CPCC12N9/2402C12P19/44
Inventor 何冰芳叶家捷储建林吴斌
Owner NANJING TECH UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More