Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Primer combination used for synchronously detecting four infectious disease viruses of pigs and detection kit

A combination of primers and simultaneous detection technology, which is applied in the field of porcine infectious disease virus detection, can solve problems such as difficulties in popularization and application, decreased lactation volume, and large sample volume, and achieve the goals of reducing false positives, improving detection efficiency, and high sensitivity Effect

Pending Publication Date: 2018-09-07
WUHAN UNIV
View PDF6 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

7-day-old piglets usually die due to severe dehydration within 2-4 days after diarrhea, and the mortality rate can reach more than 50%. decreased milk production
At present, there have been reports on the detection of CSFV, PRRSV, PEDV or TGEV genomic nucleic acid by PCR or qPCR. Time-consuming, heavy workload and high cost defects make it difficult to popularize and apply in clinical early diagnosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer combination used for synchronously detecting four infectious disease viruses of pigs and detection kit
  • Primer combination used for synchronously detecting four infectious disease viruses of pigs and detection kit
  • Primer combination used for synchronously detecting four infectious disease viruses of pigs and detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] [Example 1] Composition and preparation of nucleic acid synchronous rapid detection and screening kits for four infectious diseases of pigs

[0042] 1. Reagent composition: Trizol RNA lysate, 5×RT Buffer, dNTPs, M-MLV enzyme 200U, d(N) 9 100ng / μL, RiboLock RNase Inhibitor (40U / μL) are all products of Invitrogen; Taq DNA polymerase 2.5U (Dongsheng Biotech) Co., Ltd. products; detection primers: CSFV, PRRSV, PEDV, TGEV four virus PCR primers mixed in equal proportions Component; reverse transcription primer: random primer d(N) 9 The product of Shanghai Sangon Bioengineering Co., Ltd.; the positive quality control plasmids of four viruses, CSFV, PRRSV, PEDV, and TGEV, were constructed and preserved by the inventor's laboratory;

[0043] The PCR primer sequences are as follows:

[0044] CSFV forward primer sequence: 5'GCTCCCTGGGTGGTCTAAGTC 3'

[0045] Reverse primer sequence: 5'GGGTTAAGGTGTGTCTTGGGC 3'

[0046] PRRSV forward primer sequence: 5'ACCTCCAGATGCCGTTTGTG 3'

...

Embodiment 2

[0074] [Example 2] Method for using the nucleic acid synchronous rapid detection and screening kit for four infectious diseases of pigs

[0075] 1. Sample Processing

[0076] Specimens involved in disease sample testing include respiratory samples (nasal / pharyngeal swabs, sputum, nasopharyngeal aspirate, bronchoalveolar lavage fluid, etc.), anal swabs, feces, blood and tissues (liver, kidney, spleen, lymph nodes, etc.) , tonsils) etc.

[0077] If the sample liquid contains a small amount of mucus (nasal / pharyngeal swab, nasopharyngeal aspirate, bronchoalveolar lavage fluid, blood, etc.), put the sample in a centrifuge at 4°C and 2000rpm for 20min to remove impurities. After centrifugation, gently open the centrifuge tube in a safety cabinet, pipette the supernatant into an EP tube for RNA extraction.

[0078] If the sample is anal swab and feces, it needs to be properly diluted with PBS buffer, centrifuged in a centrifuge at 4°C, 2000rpm for 20min to remove impurities, gentl...

Embodiment 3

[0095] [Example 3] Application of nucleic acid synchronous rapid detection and screening kits for four infectious diseases of pigs

[0096] 1. Sensitivity test

[0097] The standard substance (10 6 ~10 1 copy / μL) as a template, added to the PCR reaction solution of the detection kit, carried out the amplification reaction on the PCR instrument according to the amplification reaction conditions during the sample detection, and the PCR amplification products were analyzed by 2% agarose gel electrophoresis ( Figure 4 ).

[0098] 2. Specificity test

[0099] RSV, H5N1, BVDV and PCV2 viruses were tested using 4 kinds of virus simultaneous rapid detection kits including CSFV, PRRSV, PEDV and TGEV. Negative and positive quality controls were compared, and all non-target virus detection results were negative and positive. Quality controls have purposeful bands. The above results prove that the kit has good specificity in the detection of clinical samples.

[0100] 3. Repeatabil...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer combination used for synchronously detecting four infectious disease viruses of pigs and a detection kit. Particularly, four pairs of primers are adopted, and main fulminating infectious disease pathogens including one or any of classical swine fever virus CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine epidemic diarrhea virus (PEDV) andtransmissible gastroenteritis virus (TGEV) of the pigs can be synchronously and quickly detected and discriminated through a RT-PCR one time. The primer combination has the advantages of high specificity and sensitivity, short time and synchronous detection and discrimination, and the primer combination is suitable for monitoring of the epidemic situation of a pig farm and rapid diagnosis of pigdiseases.

Description

technical field [0001] The invention belongs to the detection of porcine infectious disease viruses, and in particular relates to a primer combination for synchronously detecting four kinds of porcine infectious disease viruses and a detection kit containing the primer combination. Background technique [0002] Classical swine fever virus (CSFV), porcine respiratory and reproductive syndrome virus (PRRSV), porcine epidemic diarrhea virus (PEDV) and porcine transmissible gastroenteritis virus (TGEV) The pathogens of important pig infectious diseases such as gastroenteritis and gastroenteritis have caused serious harm to the pig industry; the occurrence and prevalence of pig diseases are usually mixed infection of two or more pathogens, which cause disease together, with atypical clinical symptoms and more serious harm. Diagnosis and prevention and control are extremely difficult. Timely and accurate diagnosis of infectious disease pathogens is an important prerequisite for e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/701C12Q2600/16C12Q2600/166C12Q2537/143C12Q2545/113C12Q2547/101
Inventor 潘兹书赵妍刘菲菲雷蕾
Owner WUHAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com