7beta-hydroxyl sterol dehydrogenase mutant and application thereof to preparation of ursodeoxycholic acid

A technology of hydroxysterol dehydrogenase and mutant, which is applied to 7β-hydroxysterol dehydrogenase mutant and its application field in the preparation of ursodeoxycholic acid, can solve the problem of high price, high application cost of coenzyme and catalyst preparation process Cumbersome and other problems, to achieve the effect of improving thermal stability and efficient utilization

Active Publication Date: 2018-09-18
EAST CHINA UNIV OF SCI & TECH +1
View PDF8 Cites 29 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the existing reports, the expression of recombinant 7β-HSDH uses Escherichia coli as the host, and the expressed enzyme is an intracellular enzyme, which requires cell disruption of the recombinant bacteria to obtain the enzyme solution, and the catalyst preparation process is cumbersome; and currently The reported recombinant 7β-HSDH is NADPH-dependent, and the coenzyme NADPH or NADP needs to be added to the enzymatic reaction solution + (converted to NADPH by the coenzyme regeneration system), due to the coenzyme NADPH or NADP + Expensive, high cost of coenzyme application is the limiting factor for enzymatic industrial production of UDCA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 7beta-hydroxyl sterol dehydrogenase mutant and application thereof to preparation of ursodeoxycholic acid
  • 7beta-hydroxyl sterol dehydrogenase mutant and application thereof to preparation of ursodeoxycholic acid
  • 7beta-hydroxyl sterol dehydrogenase mutant and application thereof to preparation of ursodeoxycholic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0071] Example 1 Site-directed mutation of 7β-HSDH

[0072] Through Uniprot, NCBI BLAST and spatial structure modeling, the amino acid residues around the binding site of the coenzyme NADPH include: amino acid, 18-position glutamic acid, 22-position lysine, 39-position glycine, 44-position lysine and 67-position phenylalanine, etc. Using site-directed mutagenesis technology, the amino acid residues at these sites were subjected to site-directed mutation. Through screening, it was found that the 17th threonine was replaced by alanine (T17A), and the 18th glutamic acid was replaced by threonine (E18T). ), the 22nd lysine was replaced with aspartic acid (K22D), the 39th glycine was replaced with aspartic acid (G39D), the 44th lysine was replaced with glycine (K44G), the 67th phenylpropanoid Mutants such as amino acid replaced by alanine (F67A) greatly increased the activity of NADH, and correspondingly, the specific activity of NADPH decreased significantly.

[0073] The 7β-HSD...

Embodiment 2

[0074] Example 2 Construction of 7β-HSDH mutants

[0075] On the basis of the mutant described in Example 1, the error-prone PCR technique was used for random mutation to further improve the activity of the enzyme.

[0076] According to the open reading frame of 7β-HSDH, design upstream and downstream primers as follows:

[0077] Upstream primer, as shown in SEQ ID No.3:

[0078] CCG GAATTC ATGAATCTGCGTGAAAAATAC

[0079] Downstream primer, as shown in SEQ ID No.4:

[0080] CCG CTCGAG TTAATTGTTGCTATAGAAGC

[0081] Wherein, the sequence indicated by the underline of the upstream primer is the restriction site of EcoR I, and the sequence indicated by the underline of the downstream primer is the restriction site of Xho I.

[0082] Using pET28a-7β-HSDH as a template, error-prone PCR was performed with rTaq DNA polymerase to construct a random mutation library. PCR system (50 μL): rTaq DNA polymerase 0.5 μl, 10×PCR buffer (Mg 2+ Plus) 5.0 μl, dNTP Mixture (2.0 mM each) 4...

Embodiment 3

[0105] Example 3 Recombinant E.coli BL21(DE3) / pET28a-7β-HSDH M12 expression and activity assay

[0106] The recombinant Escherichia coli E.coli BL21(DE3) / pET28a-7β-HSDH of the mutant M12 obtained in Example 2 M12 Inoculated into the LB medium containing 50 μg / ml kanamycin, cultured in a shaker at 37°C for 12 hours, and then inserted into 100ml LB medium (containing 50 μg / ml Kanamycin) in a 500ml Erlenmeyer flask, placed at 37°C, 180rpm shaker culture, when the OD of the culture solution 600 When it reached 0.6, IPTG with a final concentration of 0.2mmol / L was added as an inducer and induced at 16°C for 24h. The culture solution was centrifuged at 8000×g for 10 min, the cells were collected, and washed twice with saline to obtain resting cells. Suspend the cells obtained in 100ml of culture medium in 10ml of potassium phosphate buffer (100mM, pH 8.0), and perform the following ultrasonic disruption in an ice-water bath: 400W power, working for 4s, intermittent for 6s, for 99...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
specific rotationaaaaaaaaaa
purityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a 7beta-hydroxyl sterol dehydrogenase mutant which is obtained by protein engineering and of which coenzyme preference is changed, a coding gene of the 7beta-hydroxyl sterol dehydrogenase mutant, a recombinant expression vector and a recombinant expression transformant which contain a sequence of the gene, a preparation method of a recombinant mutant enzyme preparation, andapplication of the recombinant mutant enzyme preparation to preparation of ursodeoxycholic acid. By co-enzyme regeneration of enzymic coupling, the recombinant mutant enzyme preparation disclosed bythe invention can efficiently utilize relatively cheap oxidized coenzyme I (NAD+) instead of very expensive oxidized coenzyme II (NADP+); asymmetric reduction of catalytic 7-hydroxyl lithocholic acideffectively reduces production cost; moreover, the recombinant mutant enzyme preparation has the advantages of simplicity for operation, mild reaction condition, environmental-friendliness, high yieldand the like, and has a good application prospect in preparation of ursodeoxycholic acid by epimerization of chenodesoxycholic acid.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and specifically relates to a 7β-hydroxysterol dehydrogenase mutant with a changed coenzyme preference, its coding gene and amino acid sequence, a recombinant expression vector containing the gene sequence and a recombinant expression transformant, recombinant 7β - A preparation method of a hydroxysterol dehydrogenase catalyst, and an application of the recombinant 7β-hydroxysterol dehydrogenase catalyst in the preparation of ursodeoxycholic acid. Background technique [0002] Ursodeoxycholic acid (Ursodeoxycholic Acid, UDCA) is the active ingredient of bear bile, a precious Chinese herbal medicine, and its chemical name is 3α,7β-dihydroxy-5β-cholestane-24-acid Deoxycholic acid is a drug approved by the US FDA for the treatment of primary biliary cirrhosis. It is also used to treat primary sclerosing cholangitis, alcoholic and fatty liver disease, viral hepatitis, and drug-induced hepatiti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/04C12N15/53C12P33/06
CPCC12N9/0006C12P33/06C12Y101/01201
Inventor李春秀游智能许建和陈琦潘江钱小龙
OwnerEAST CHINA UNIV OF SCI & TECH