Meloidogyne graminicola translation elongation factor Mg-eFF1A and application thereof to control of plant diseases

A technique for translating elongation factors and root-knot nematodes, applied in angiosperms/flowering plants, applications, nematicides, etc., can solve the problems of undiscovered nematode-related molecular patterns and undiscovered receptors

Active Publication Date: 2018-10-02
SOUTH CHINA AGRI UNIV
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Pheromones are small molecular compounds that are the only nematode-associated molecular patterns found in plant-parasitic nematodes, but protein-based nematode-associated molecular patterns have not yet been discovered
Moreover, the current research has not yet found the receptors that directly interact with plant and nematode PAMPs (or called NAMPs)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Meloidogyne graminicola translation elongation factor Mg-eFF1A and application thereof to control of plant diseases
  • Meloidogyne graminicola translation elongation factor Mg-eFF1A and application thereof to control of plant diseases
  • Meloidogyne graminicola translation elongation factor Mg-eFF1A and application thereof to control of plant diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1 Mg-eEF1A clone

[0043] According to the transcriptome data of M. graminearum, the full-length cDNA sequence of Mg-eEF1A gene was spliced. Subsequently, primers Mg-eEF1A-gDNA-F / Mg-eEF1A-gDNA-R covering the full-length sequence were designed to amplify the genome sequence.

[0044] SEQ ID NO.4 (Primer Mg-eEF1A-gDNA-F)

[0045] ATGGGAAAAGAAAAGATTC

[0046] SEQ ID NO.5 (Primer Mg-eEF1A-gDNA-R)

[0047] TTATTTCTTCTTTCCAGCAG

[0048] The amplified Mg-eEF1A gene has a full length of 1650 bp (shown in SEQ ID NO.1), contains 6 short introns, and encodes 465 amino acids (shown in SEQ ID NO.2).

[0049] Through homologous comparison, it was found that Mg-eEF1A is very conserved in nematodes ( figure 1 ).

Embodiment 2

[0050] Example 2 Yeast two-hybrid

[0051] 1. Experimental method

[0052] (1) Collect the 2nd instar larvae before root-knot nematode infection, use Trizol regent to extract the total RNA of nematodes, and use DNase 1 to remove residual DNA. The specific operation process is as follows:

[0053] Collect root-knot nematode graminaceae in a 1.5 ml centrifuge tube, use a suitable grinding rod to crush the insect body in a liquid nitrogen environment, and add 1 ml of Trizol regent to mix. Let stand at room temperature for 5 min to completely dissociate ribosomes. Add 200 μl of chloroform to the above lysate, shake vigorously for 15 seconds, repeat 3 times, and let stand at room temperature for 2 minutes. Centrifuge at 12,000 rpm at 4°C for 15 min, carefully pipette the upper layer into a new centrifuge tube, add an equal volume of isopropanol, mix by inverting up and down, and place at room temperature for 30 min. Centrifuge at 12,000 rpm at 4°C for 15 min, remove the supernat...

Embodiment 3

[0066] Example 3 Co-immunoprecipitation

[0067] 1. Experimental method

[0068] OsCERK1Δsp and Mg-eEF1A without the signal peptide region were obtained by PCR and cloned into the rice protoplast transient expression vector pUbi to obtain pUbi:OsCERK1Δsp:HA and pUbi:Mg-eEF1A:EGFP. At the same time, a plant expression vector pUbi:EGFP was constructed as a negative control. pUbi:OsCERK1Δsp:HA was co-expressed with pUbi:Mg-eEF1A:EGFP and pUbi:EGFP respectively in rice protoplasts. After 48 hours, the protoplast cells were collected and the total protein was extracted. The extraction method of the total protein was carried out according to 2.3.7. The method of co-immunoprecipitation was carried out according to the instructions of EZview Red Anti-HA Affinity Gel (sigma), and the process was as follows: first, EZview Red Anti-HA Affinity Gel was added to the total protein, and incubated overnight at 4°C; then, washed with the protein extract 4-5 times, collect the precipitate; a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a meloidogyne graminicola translation elongation factor Mg-eFF1A and the application thereof to the control of plant diseases. A genomic sequence of the Mg-eFF1A is as shown inSEQ ID NO.1, and an amino acid sequence is as shown in SEQ ID NO.2. The Mg-eFF1A is firstly discovered, the fact that the Mg-eFF1A can be secreted to the exterior of body of meloidogyne graminicola,and the Mg-eFF1A can activate an immune system of a host during invasion of plant-parasitic nematodes, induce the fundamental immune response of paddies and disease resistance to pathogen, activate PTI immune response, such as pathogenesis-related gene expression, callose accumulation and MAP kinase phosphorylation, of the paddies, and enhance the resistance of the paddies to meloidogyne graminicola and magnaporthe grisea. In addition, researches find that the Mg-eFF1A can induce plant OsCERK1 expression during invasion of the meloidogyne graminicola, and the researches open a direction and strategy with huge potential for the prevention and control of the plant-parasitic nematodes.

Description

technical field [0001] The invention belongs to the technical field of plant disease control. More specifically, it relates to a root-knot nematode pathogen-associated molecular pattern (PAMP) Mg-eEF1A and its application in controlling plant diseases. Background technique [0002] Poaceae is the family with the highest economic value, such as rice, wheat, corn, millet (millet), sorghum and other major human food crops, sugar cane crops, forage grass, bamboo, etc. belong to this family. Grasses also play an important role in other aspects such as papermaking, textiles, turf paving, bank protection, and soil and water conservation. Rice root-knot nematode and rice blast are common diseases of Poaceae, causing a lot of economic losses and damage. Therefore, its disease control is of great significance and value. [0003] Organisms have evolved a variety of ways to protect themselves from other organisms or non-living organisms. In animals, the best-studied adaptive immune ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C07K14/435C12N15/82A01H5/00A01H6/46A01N47/44A01P5/00A01P3/00
CPCA01N47/44C07K14/4354C12N15/8282C12N15/8285
Inventor卓侃廖金铃陈建松林柏荣
OwnerSOUTH CHINA AGRI UNIV