A kind of swine mycoplasma pneumonia aerosol live vaccine and preparation method thereof

A technology for Mycoplasma hyopneumoniae and Mycoplasma hyopneumoniae is applied in the field of Mycoplasma hyopneumoniae pneumonia aerosol live vaccine and its preparation, and can solve the problems of inability to accurately evaluate the activity of aerosol vaccines, low efficiency of liquid vaccines, low immune protection rate, etc. Conducive to large-scale promotion, automation, and high immune protection effects

Active Publication Date: 2021-08-17
JIANGSU ACAD OF AGRI SCI
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In this invention patent, the vaccine quantitative collection device used can only collect the aerosol vaccine that has not been completely dispersed and stays in the air for a certain period of time when the atomization has just occurred (if it is collected after the atomization, the collected aerosol vaccine is relatively small. less, the efficiency of transforming into liquid vaccines is too low), it is impossible to accurately evaluate the influence of environmental factors on the activity of aerosol vaccines
During the follow-up research, the applicant found that although the titer of the vaccine solution was lower when the aerosol vaccine was first formed, the activity decreased significantly with the prolongation of the residence time in the air, resulting in a lower immune protection rate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of swine mycoplasma pneumonia aerosol live vaccine and preparation method thereof
  • A kind of swine mycoplasma pneumonia aerosol live vaccine and preparation method thereof
  • A kind of swine mycoplasma pneumonia aerosol live vaccine and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Preparation and inspection of embodiment 1 mycoplasma pneumoniae aerosol live vaccine

[0025] 1. Strains

[0026] 168 strains of mycoplasma hyopneumoniae freeze-dried strains, each bottle is equipped with 2ml culture of 168 strains of mycoplasma hyopneumoniae before freeze-drying.

[0027] 2. Vaccine diluent preparation

[0028] Vaccine diluent A is the aqueous solution that contains following material: 0.1g / L chitosan (molecular weight 150KDa), 20g / LPEG6000 (polyethylene glycol 6000), 2g / L cyclodextrin, 10g / L sodium thiosulfate, 10g / L L-histidine, pH 7.4.

[0029] The specific preparation method is as follows:

[0030] (1) First dissolve polyethylene glycol 6000, cyclodextrin, sodium thiosulfate and L-histidine in water, and adjust the pH value to 7.4 to obtain a vaccine protection agent solution.

[0031] (2) After the chitosan powder is dropped into an appropriate amount of acetic acid aqueous solution and fully dissolved, the pH is adjusted to neutrality with ...

Embodiment 2

[0051] The particle diameter detection of embodiment 2 different concentration aerosol vaccines

[0052] Diluent A is an aqueous solution containing the following substances: 3g / L chitosan (molecular weight 150KDa), 20g / L PEG6000, 2g / L cyclodextrin, 10g / L sodium thiosulfate, 10g / L L-histidine, pH 7.4.

[0053] Take 10 bottles of freeze-dried strains of 168 strains of Mycoplasma hyopneumoniae, dissolve them with 20ml of diluent A (the volume ratio of bacteria and diluent before freeze-drying is 1:1), take 2ml of the vaccine solution and add 198ml of diluent A (before freeze-drying The volume ratio of bacteria and diluent is 1:100). Two kinds of vaccine solutions with different concentrations were poured into an ultrasonic nebulizer for atomization, and the oscillation frequency was 1.7 MHz, and the aerodynamic particle diameter of the aerosol vaccine particles was detected respectively according to the particle diameter detection method in Example 1, and repeated three times ...

Embodiment 3

[0058] The concentration of effective antigen in the different concentration aerosol vaccine of embodiment 3

[0059] Diluent A is an aqueous solution containing the following components: CpG (sequence TCGTCGTTGTCGTTTTGTCGTT) 100mg / L, PEG6000 20g / L, cyclodextrin 2g / L, sodium thiosulfate 10g / L, L-histidine 10g / L, pH Value 7.4.

[0060] Diluent B is an aqueous solution containing the following substances: ISCOM (immune stimulating complex, disclosed in Xiong et al., 2014.Protective efficacy of a live attenuated Mycoplasma hyopneumoniaevaccine with an ISCOM-matrix adjuvant in pigs.The Veterinary Journal 199:268-274 .) 0.5g / L, PEG6000 20g / L, cyclodextrin 2g / L, sodium thiosulfate 10g / L, L-histidine 10g / L, pH 7.2.

[0061] Control diluent 1: deionized aqueous solution containing 5% glycerin and 0.1% polyvinylpyrrolidone, pH 7.5.

[0062] Get 10 bottles of 168 strains of Mycoplasma hyopneumoniae freeze-dried strains, according to the instructions of the cell proliferation tracer fl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a live aerosol vaccine of swine mycoplasma pneumonia and a preparation method thereof, relating to the field of animal vaccines. The aerosol live vaccine is obtained by atomizing a vaccine solution obtained by suspending an attenuated strain of Mycoplasma hyopneumoniae in a vaccine diluent; the diluent is an aqueous solution containing the following components: polyethylene glycol Alcohol 6000 10~50 g / L, cyclodextrin 1~10 g / L, sodium thiosulfate 5~20 g / L, L‑histidine 10~20 g / L, pH 6.8‑7.6. The present invention also provides a preparation method of the vaccine, comprising: preparing a solution with a vaccine diluent from the bacteria solution or freeze-dried product of the attenuated strain of Mycoplasma hyopneumoniae, and preparing a live aerosol vaccine by ultrasonic atomization; the live aerosol vaccine The aerodynamic mass median particle size is 1-5μm, and the effective antigen concentration is not less than 50%. The live vaccine of the invention still has relatively high titer after staying in the air for 30 minutes, has high immune protection rate, long immune duration, simple preparation and low cost.

Description

technical field [0001] The invention relates to the field of animal vaccines, in particular to a live aerosol vaccine of mycoplasma swine pneumonia and a preparation method thereof. [0002] technical background [0003] Mycoplasma pneumonia is a contact chronic respiratory infectious disease caused by Mycoplasma hyopneumoniae infection. The disease spreads all over the world, and it is easy to have mixed infection with other pathogens, causing more serious lung lesions and greater economic losses. Vaccination is the main way to prevent the disease. At present, the vaccines available on the market are mainly divided into imported inactivated vaccines and domestic attenuated vaccines. Since Mycoplasma hyopneumoniae only partially colonizes the lower respiratory tract such as the bronchi and bronchioles of pigs, it does not enter the whole body with the blood circulation. Therefore, serum antibodies produced after immunization with inactivated M. hyopneumoniae vaccine have n...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): A61K39/02A61K47/40A61K9/12A61P31/04
CPCA61K9/0078A61K9/12A61K39/0241A61K47/40A61K2039/522A61K2039/552A61P31/04
Inventor冯志新邵国青熊祺琰白昀韦艳娜甘源袁厅张珍珍林家彬
OwnerJIANGSU ACAD OF AGRI SCI