Check patentability & draft patents in minutes with Patsnap Eureka AI!

Pyruvate kinase gene and application thereof

A kind of pyruvate kinase, gene technology, applied in the field of genetic engineering

Active Publication Date: 2019-02-15
INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
View PDF19 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the function of pyruvate kinase gene in plants, especially in the model leguminous plant Medicago truncatula, is still unknown. In view of the multiple functions of pyruvate kinase, as well as its role in plant metabolism and potential application value, cloning and identification are of great importance. Functional, specific and biologically active plant pyruvate kinase genes are of great theoretical and practical value

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pyruvate kinase gene and application thereof
  • Pyruvate kinase gene and application thereof
  • Pyruvate kinase gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] The present invention discovers a pyruvate kinase gene MtPK1, the gene sequence of which is shown in SEQ ID NO.1. In the sequence shown in SEQ ID NO.1, ATG is the start codon and TGA is the stop codon. The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2. Its use is heterologous expression of pyruvate in other organisms, and overexpression in Medicago truncatula can produce flavonoids.

[0025] The identification method of pyruvate kinase gene of the present invention comprises the following steps:

[0026] (1) Cloning of the full-length fragment of the MtPK1 gene

[0027] PCR reactions were performed according to the Phusion high-fidelity DNA polymerase instructions provided by Thermo Fisher Scientific (Table 1, Table 2).

[0028] Table 1 Phusion enzyme reaction system

[0029]

[0030] The sequence of the Forward primer is: ATGATGGCAGAGAAGAAACC; the sequence of the Reverse primer is: TCATTTCACAGTCAAGATTTTG

[0031] Table 2. PCR pro...

Embodiment 2

[0071] According to the annotations in NCBIgenbank and KEGG SSDB databases, the full-length sequences of 13, 10 and 12 pyruvate kinases were obtained from Arabidopsis thaliana, rice and Medicago truncatula, respectively, for sequence alignment and evolution analysis.

[0072] DNAMAN was used for amino acid sequence homology comparison analysis, and the conserved domains contained in it were analyzed according to the Pfam 31.0 database; a phylogenetic tree was constructed using the Neighbor-joining method using Mega7 software.

[0073] In the present invention, bioinformatics analysis is carried out on the amino acid sequence encoded by MtPK1. The amino acid sequence of MtPK1 and its homologous protein were subjected to multiple sequence alignment analysis, and the results of the comparison analysis are shown in figure 1 , figure 1 The β barrel and α / β domains of pyruvate kinases are at amino acid positions 8-350 and 367-493, respectively; solid lines represent the conserved d...

Embodiment 3

[0076] The coding sequence of MtPK1 was cloned with primers MtPK1SalF and MtPK1BamR with restriction enzyme sites, and the PCR product was digested by SalI and BamHI and connected into the same restriction enzyme digested vector pJIT163-hGFP to construct the fusion gene MtPK1- hGFP. The correctly sequenced constructs were introduced into Arabidopsis leaf protoplasts. Incubate at 25°C for 16 hours, detect fluorescence with a Leica laser scanning confocal microscope, and use pJIT163-hGFP as a positive control.

[0077] In order to further confirm that MtPK1 belongs to cytoplasmic pyruvate kinase, the present invention constructed a transient expression vector of MtPK1-hGFP fusion expression driven by the CAMV 35S promoter, and transformed it into protoplasts of Arabidopsis mesophyll cells, and observed it with a Leica laser confocal microscope Localization of fluorescent proteins. The green fluorescent signal of GFP in the cytoplasmic region is clearly visible, whereas the aut...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pyruvate kinase gene. The gene sequence of pyruvate kinase is shown as SEQ ID NO.1. The coded amino acid sequence of the pyruvate kinase gene is shown as SEQ ID NO.2. The gene sequence of pyruvate kinase is derived from Medicago truncatula. The pyruvate kinase gene is cloned from the Medicago truncatula and functions of the pyruvate kinase gene are identified systematically, it is discovered that the gene not only can catalyze phosphoenolpyruvate to form pyruvate, but also can participate in biosynthesis of flavonoids.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a pyruvate kinase gene and its application. Background technique [0002] Pyruvate kinase (PK), is one of the key regulatory enzymes in the glycolysis process. PK transfers the phosphate group of phosphoenolpyruvate (PEP) to ADP through transphosphorylation, forming a molecule of ATP and a molecule of pyruvate. Pyruvate kinase is crucial to the control of metabolic flux through the glycolytic pathway, and more importantly, its substrate phosphoenolpyruvate and product pyruvate are involved in a variety of metabolic processes. For example: pyruvate enters the tricarboxylic acid cycle of mitochondria, and phosphoenolpyruvate is used as an intermediate substance for the conversion of glycolysis products to protein and fatty acid synthesis, and its content affects multiple metabolic processes in plants. Phosphoenolpyruvate is involved in the process of genera...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/12C12N15/54C12N15/70C12P17/06
CPCC12N9/1205C12N15/70C12P17/06C12Y207/0104
Inventor 庞永珍范存莹狄少康
Owner INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More