Protease and method for preparing low-cadmium rice polypeptide from protease

A protease, rice protein technology, applied in the field of biological enzymes, can solve the problems of inability to directly and effectively remove, increase production costs, increase exogenous additives and processing procedures, etc., achieve short reaction cycle, reduce industrial production costs, and enzymatic hydrolysis The effect of mild reaction conditions

Inactive Publication Date: 2019-03-01
湖南点道生物科技有限公司
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, limited by the process conditions, the hydrolysis process cannot directly and effectively remove the heavy metal cadmium ions in the rice protein solution. If the targeted adsorption of cadmium ions is not carried out, the quality defect of cadmium exceeding the standard will easily occur; if the cadmium is introduced before / after the hydrolysis treatment Additional cadmium adsorption process increases exogenous additives and processing procedures, which increases production costs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protease and method for preparing low-cadmium rice polypeptide from protease
  • Protease and method for preparing low-cadmium rice polypeptide from protease
  • Protease and method for preparing low-cadmium rice polypeptide from protease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Protease strain screening

[0030] The soil of the rice planting area was used as the strain selection source.

[0031] Take 10g of the sample and add it to a conical flask filled with 90mL of sterile water, shake and mix for 10min, and then dilute with a 10-fold serial dilution method. Take 0.1mL of 10 -6 The diluted solution was added to protease-producing screening medium containing 100, 200, 400, 600, 800 mg / L cadmium, coated evenly, and placed upside down in a 30°C incubator. Using the medium without cadmium as a control, the single colony with a relatively large transparent circle obtained on each medium was obtained by streaking on a plate to obtain a pure culture.

[0032] The obtained high protease-producing strains were cultured to a bacterial concentration of 1.0×10 9 ~5.0×10 9 CFU / mL, centrifuge separately, add cadmium solution [CdCl 2 ·5H 2 O], shake treatment at 45°C for 4h, set 3 repetitions, and take the treatment of adding the same amount...

Embodiment 2

[0036] The preparation of embodiment 2 protease

[0037] The protease derived from Bacillus sp.D12 was codon-optimized to obtain the gene sequence shown in SEQ ID NO.2. The gene shown in SEQ ID NO.2 was synthesized, and the plasmid pMA5 was double digested with restriction endonucleases BamHI and NheI (primers were respectively F: GGATCCATGAAACATACAGATAAAGTTGGCC; R: GCTAGCGATGTAAGCAGCTTTGAAAGCTTGT, and agarose gel electrophoresis was used for gel cutting and recovery. Recover the product for ligation, system 10 μL: 1 μL double-cut vector, 4 μL double-cut target fragment, 5 μL Solution I ligase, ligate overnight at 16°C to obtain pMA5-neutrase; transform JM109 competent cells, pick single colony PCR verification, positive The recombinant was sequenced, and the alignment was correct to obtain recombinant Bacillus subtilis 168pMA5-neutrase (abbreviated as Bacillus subtilis NEU) expressing neutral protease.

[0038] Streak Bacillus subtilis NEU on a solid LB plate containing 50 μ...

Embodiment 3

[0040] The adsorption efficiency of embodiment 3 protease under different conditions

[0041] Prepare PBS buffer (pH 7.0) with a cadmium ion concentration of 10 mg / L, add the protease prepared in Example 2 with a final concentration of 1000 U / mL, react at 40-60° C. for 4 hours, and measure the cadmium adsorption rate. The results showed that the adsorption rate of cadmium was more than 75% at 40-50°C, and the adsorption rate could reach 84.2% when the reaction temperature was 45°C ( figure 2 ).

[0042]Prepare a reaction system with a pH of 5-8 according to the same steps above, add the protease prepared in Example 2 at a final concentration of 1000 U / mL, react at 45°C for 4 hours, and measure the cadmium adsorption rate. The results show that when the pH is 6-7, the adsorption rate of cadmium reaches more than 84.2%, and when the pH is 6.5, the adsorption rate can reach 84.2% ( image 3 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses protease and a method for preparing low-cadmium rice polypeptide from the protease, and belongs to the technical field of bio-enzymes. The neutral protease suitable for industrial production provided by the invention has the advantages that the enzyme activity can be up to 5898.5 U / mL, the cadmium ion adsorption capability is realized, the enzymatic hydrolysis reaction conditions are mild, the reaction period is short, and one-step hydrolysis and adsorption can be realized. The content of rice protein peptide prepared from the protease is up to 97.2 percent, the cadmiumcontent is only 0.078 mg / kg, and the cadmium adsorption rate is 90 percent or above. By adopting the method, the industrial production cost can be lowered effectively, and green production of safe foods is realized.

Description

technical field [0001] The invention relates to a protease and a method for preparing low-cadmium rice polypeptide, belonging to the technical field of biological enzymes. Background technique [0002] Cadmium is a toxic metal that is harmful to human health. In 1974, the United Nations Environment Program and the International Labor Health Heavy Metal Committee identified it as a key pollutant. of toxic substances. With the rapid development of China's industrialization, a large amount of heavy metals enter water bodies in various ways, causing serious pollution of surface water and groundwater, which in turn seriously pollutes soil or crops irrigated by polluted water sources, which greatly affects the food safety of crops and economic value. [0003] Rice protein is a high-quality, low-allergenic high-quality grain protein with a good amino acid ratio and contains eight kinds of amino acids necessary for the human body. It is very suitable as a protein supplement for th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/50C12N15/57C12N1/21C12P21/06C12R1/125
CPCC12N9/50C12P21/06
Inventor谢艳萍何球山谭启程张国军
Owner湖南点道生物科技有限公司