Bacillus natto capable of reducing blood glucose, preparation method and application
A Bacillus natto, hypoglycemic technology, applied in the direction of biochemical equipment and methods, applications, chemical instruments and methods, etc., can solve the problem of single mechanism, achieve the effects of convenient preparation, increase sensitivity, and reduce insulin resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] The present invention provides a hypoglycemic Bacillus natto, said hypoglycemic Bacillus natto is the GLP-1 gene transformed with the site-directed mutation of the second amino acid shown in SEQ ID NO.1 in Bacillus natto sequence.
Embodiment 2
[0034] Based on the same inventive concept, the present invention also provides a method for preparing the hypoglycemic Bacillus natto, comprising the following steps:
[0035] S1, synthesize the GLP-1 gene sequence of the second amino acid site-directed mutation, the gene sequence is used to encode glucagon literacy peptide-1 (GLP-1), the GLP-1 gene sequence of the second amino acid site-directed mutation is shown as SEQ ID NO.1 shows:
[0036] 5'-tactcgagaaaaga catggtgaagggacctttaccagtgatgtaagttcttatttggaaggccaa gctgccaaggagttcattgcttggctggtgaaaggccgagcg gccgcat-3', the underlined part is the GLP-1 gene sequence with the site-directed mutation of the second amino acid, the 5' end contains the Xho I restriction sequence and the signal peptide terminal sequence, and the 3' end is the GLP-1 gene sequence with the site-directed mutation of the second amino acid. 1. The end sequence of the gene sequence contains the Not I enzyme cutting sequence;
[0037] The amino acid sequ...
Embodiment 3
[0055] A method for preparing a preparation for treating type Ⅱ diabetes by using the hypoglycemic Bacillus natto:
[0056] Inoculate the hypoglycemic Bacillus natto prepared in Example 2 into a lactose-free common broth sterilized by steam autoclaving, culture at 37°C for 16-24 hours, centrifuge at 3000-4000rpm for 30 minutes, collect the precipitate, freeze-drying at 50-20 DEG C to obtain directly edible Bacillus natto powder. Lactose is added in proportion to the Bacillus natto bacteria powder, so that the number of colonies reaches 10 8 More than CFU / g, the contained lactose accounts for 5-50% of the total mass of Bacillus natto bacteria powder.
[0057] Add food raw materials to the Bacillus natto powder to make a health food with hypoglycemic effect; or add starch or dextrin to the Bacillus natto powder and prepare it into tablets according to the pharmaceutical process or powder.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

