Unlock instant, AI-driven research and patent intelligence for your innovation.

Bacillus natto capable of reducing blood glucose, preparation method and application

A Bacillus natto, hypoglycemic technology, applied in the direction of biochemical equipment and methods, applications, chemical instruments and methods, etc., can solve the problem of single mechanism, achieve the effects of convenient preparation, increase sensitivity, and reduce insulin resistance

Pending Publication Date: 2019-04-19
XIAN PEIHUA UNIV
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, the drug action mechanism in the prior art is single, and the main purpose is only to lower blood sugar

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus natto capable of reducing blood glucose, preparation method and application
  • Bacillus natto capable of reducing blood glucose, preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] The present invention provides a hypoglycemic Bacillus natto, said hypoglycemic Bacillus natto is the GLP-1 gene transformed with the site-directed mutation of the second amino acid shown in SEQ ID NO.1 in Bacillus natto sequence.

Embodiment 2

[0034] Based on the same inventive concept, the present invention also provides a method for preparing the hypoglycemic Bacillus natto, comprising the following steps:

[0035] S1, synthesize the GLP-1 gene sequence of the second amino acid site-directed mutation, the gene sequence is used to encode glucagon literacy peptide-1 (GLP-1), the GLP-1 gene sequence of the second amino acid site-directed mutation is shown as SEQ ID NO.1 shows:

[0036] 5'-tactcgagaaaaga catggtgaagggacctttaccagtgatgtaagttcttatttggaaggccaa gctgccaaggagttcattgcttggctggtgaaaggccgagcg gccgcat-3', the underlined part is the GLP-1 gene sequence with the site-directed mutation of the second amino acid, the 5' end contains the Xho I restriction sequence and the signal peptide terminal sequence, and the 3' end is the GLP-1 gene sequence with the site-directed mutation of the second amino acid. 1. The end sequence of the gene sequence contains the Not I enzyme cutting sequence;

[0037] The amino acid sequ...

Embodiment 3

[0055] A method for preparing a preparation for treating type Ⅱ diabetes by using the hypoglycemic Bacillus natto:

[0056] Inoculate the hypoglycemic Bacillus natto prepared in Example 2 into a lactose-free common broth sterilized by steam autoclaving, culture at 37°C for 16-24 hours, centrifuge at 3000-4000rpm for 30 minutes, collect the precipitate, freeze-drying at 50-20 DEG C to obtain directly edible Bacillus natto powder. Lactose is added in proportion to the Bacillus natto bacteria powder, so that the number of colonies reaches 10 8 More than CFU / g, the contained lactose accounts for 5-50% of the total mass of Bacillus natto bacteria powder.

[0057] Add food raw materials to the Bacillus natto powder to make a health food with hypoglycemic effect; or add starch or dextrin to the Bacillus natto powder and prepare it into tablets according to the pharmaceutical process or powder.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of preparations of prevention and treatment of diabetes, and particularly discloses bacillus natto capable of reducing blood glucose, a preparation methodand application. The GLP-1 gene sequence shown in SEQ ID NO. 1 is cloned in a carrier and then converted into the bacillus natto, and the bacillus natto capable of reducing the blood glucose and expressing glucagon-like peptide-1 (GLP-1) is prepared. The bacillus natto is utilized for generating spores and is probiotics safe for human, the spores of the bacillus natto can resist gastric acid to reach the small intestine for growing, and under induction of lactose, the inserted GLP-1 gene is expressed, the bacillus natto is secreted into the intestinal tract, after absorption of the human body,islet cells are promoted to secrete insulin, and the effect of treating II type diabetes is achieved; large-scale production of the bacillus natto is easy, the cost is low, and the bacillus natto ismore affordable.

Description

technical field [0001] The invention belongs to the technical field of diabetes prevention and treatment preparations, and in particular relates to a hypoglycemic bacillus natto and its preparation method and application. Background technique [0002] Diabetes has been listed as the third biggest killer after cardiovascular and cerebrovascular diseases and tumors. With changes in lifestyle and diet, the global prevalence of diabetes is on the rise. It is estimated that by 2030, the number of people with diabetes in the world will increase to 366 million, and diabetes will become a heavy burden for many families and society. [0003] Type Ⅱ diabetes is the most common type. The etiology of patients with type Ⅱ diabetes is multifaceted. Some patients are due to insufficient insulin secretion. Sensitivity (i.e. insulin resistance), the vast majority of patients with type Ⅱ diabetes will inevitably be treated with drugs. According to different causes, oral hypoglycemic drugs ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/75A23L33/135A61K35/742A61P3/10C12R1/07
CPCA61P3/10A23L33/135C12N15/75C07K14/605A23V2002/00A61K2035/115A23V2200/328
Inventor 李元蔡森师长宏牛睿周玉玉李瑶窈
Owner XIAN PEIHUA UNIV