Unlock instant, AI-driven research and patent intelligence for your innovation.

Expression of recombinant human papilloma virus 52 subtype protein

A technology of human papillomavirus and human papilloma, applied in the field of production of recombinant human papillomavirus 52 subtype virus-like particles, can solve the problems of low expression level and no expression, achieve high expression level, easy operation, and benefit large scale The effect of large-scale industrial production

Active Publication Date: 2019-05-14
SHANGHAI ZERUN BIOTECHNOLOGY CO LTD
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in expression systems such as Escherichia coli, Pichia pastoris, and baculovirus, L1 protein is often limited by the frequency of amino acid codon usage in these organisms, resulting in low or no expression.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression of recombinant human papilloma virus 52 subtype protein
  • Expression of recombinant human papilloma virus 52 subtype protein
  • Expression of recombinant human papilloma virus 52 subtype protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1: HPV52L1 codon optimization design

[0051] The full-length HPV 52L1 has a total of 529 amino acid sequences, similar to other genes of the HPV L1 family, and also has two translation initiation sites, corresponding to full-length HPV 52L1 (529 amino acids) and HPV 52L1 (503 amino acids), respectively. Analysis of the first 27 amino acids of full-length HPV52L1, most of which are hydrophobic amino acids, are more likely to be transmembrane regions, which will have a certain impact on expression. Early HPV 16L1 expression studies showed that HPV 16L1 (505 amino acids) could form VLPs in various expression systems, while no VLP formation was observed for full-length HPV 16L1 (531 amino acids). Therefore, it is speculated that the two translation initiation points of high-risk HPV L1 may be related to the pathological process of cervical cancer. During the final virus assembly process, a 505 amino acid L1 coat protein is expressed (Virus Genes. 2005; 30(1):31-35...

Embodiment 2

[0055] Embodiment 2: Construction of HPV52L1 recombinant expression vector

[0056] The synthesized 52L1 sequence was cloned into pPICZalphaB vector by the following method. The 52L1 DNA fragment with BstBI and KpnI at both ends was amplified by PCR, PCR primer: forward primer: 5'CAGGTGATCTTCGAAACGATGTCCGTTTGGAGAC3'(BstBI) (SEQ ID NO: 4); reverse primer: 5'ATTGGTACCCTATTATCTCTTGACT 3' (KpnI) (SEQ ID NO: 5). PCR program: cycle 30 times at 94°C for 5 minutes, 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 1 minute and 50 seconds, 72°C for 10 minutes, 10°C for 10 minutes, and the operation ends. The PCR product was identified by agarose gel electrophoresis and the band at 1500bp was recovered (Qiagen gel extraction kit). The recovered fragments were digested with pPICZalphaB with BstBI and KpnI (New England Biolab), identified by agarose gel electrophoresis, and about 1500bp and 3600bp fragments were recovered respectively. After recovery, 52L1 and pPICZalphaB were ligated...

Embodiment 3

[0057] Example 3: Construction and expression of HPV52L1 recombinant expression strain

[0058] Linearize pPICZ52L1 with SacI. After the enzyme digestion reaction, remove the protein with phenol: chloroform, add 2.5 times the volume of absolute ethanol, and precipitate DNA with 1 / 10 volume of 3M NaAc (pH5.2). The resulting precipitate is washed with 75% ethanol and dried. ddH 2 O dissolved the precipitate, electroporated Pichia host bacteria, spread it on a YPDS plate (containing 180 μg / mL Zeocin), and cultured at 30°C for 3 days to obtain hundreds of clones. Dozens of clones were picked and inoculated on YPD plates (containing 1500 μg / mL Zeocin), screened for high-copy plasmid strains, and cultured at 30°C for 2 days. Some clones grew faster, and several clones with the best growth conditions were picked and inoculated in 5mL YPD liquid medium. After 24 hours, the BMMY medium was replaced, and the bacteria were collected after 48 hours of induction with 0.5% methanol. After...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a codon-optimized gene suitable for expressing HPV 52 type human papilloma virus main capsid protein L1 in pichia pastoris, a vector containing the gene, a strain and a methodfor expressing the gene. The invention also discloses an immunogenic macromolecule, wherein the macromolecule is mainly produced by expressing the codon-optimized human papilloma virus main capsid protein L1 encoding gene in a yeast cell. The invention also discloses the application and compositions of the immunogenic macromolecule.

Description

technical field [0001] The invention relates to a new Pichia pastoris expression system, which can be used to produce recombinant human papillomavirus 52 subtype virus-like particles. Background technique [0002] Cervical cancer is the second most common gynecological malignancy after breast cancer. More than 500,000 women worldwide are diagnosed with cervical cancer every year, and 270,000 women die from the disease, with an age-standardized infection rate of 10.5%. As early as the early 1980s, Haraldzur Hausen discovered that human papilloma virus (HPV) infection was related to the incidence of cervical cancer, and a large number of subsequent studies have also proved that HPV is closely related to cervical cancer and its precancerous lesions. So far, more than 100 HPV genotypes have been discovered, about 40 of which can infect the genital mucosa. Among them, the high-risk HPV types are HPV16, 18, 31, 33, 45, 52 and 58, and more than 90% of cervical cancers are related ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/37C12N15/81C12N1/19C07K14/025C07K1/18C07K1/16A61K39/12A61P31/20A61P35/00A61P17/12C12R1/84
CPCY02A50/30
Inventor 孟凡举周晨亮许丹杜府亮
Owner SHANGHAI ZERUN BIOTECHNOLOGY CO LTD