Trichoderma reesei engineering bacterium high in secretion of endoglucanase and beta-glucosidases and construction method and application of trichoderma reesei engineering bacterium

An endoglucanase, Trichoderma reesei technology, applied in the field of genetic engineering, can solve the problem of inability to achieve the catalytic efficiency of cellulase, optimize the endogenous multi-enzyme components of Trichoderma reesei, no construction method and application And other issues

Inactive Publication Date: 2019-06-07
SHANDONG UNIV
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, only increasing the ratio of single components cannot achieve the optimal catalytic efficiency of cellulase, therefore, it is necessary to compound and design multi-enzyme components
So far, there are no reports at home and abroad on optimizing the endogenous multi-enzyme components of Trichoderma reesei by genetic engineering to improve the catalytic efficiency of cellulase systems, let alone the dual high activity of endoglucanase and β-glucosidase. Report on secreted Trichoderma reesei genetically engineered bacteria and its construction method and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Trichoderma reesei engineering bacterium high in secretion of endoglucanase and beta-glucosidases and construction method and application of trichoderma reesei engineering bacterium
  • Trichoderma reesei engineering bacterium high in secretion of endoglucanase and beta-glucosidases and construction method and application of trichoderma reesei engineering bacterium
  • Trichoderma reesei engineering bacterium high in secretion of endoglucanase and beta-glucosidases and construction method and application of trichoderma reesei engineering bacterium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1. Construction of endoglucanase 2 expression vector pTeg2 and β-glucosidase expression vector pTHB.

[0036] First, using the genomic DNA of Trichoderma reesei QM9414 as a template, using EG2-1524UF / EG2-1813DR as primers to amplify the 3360bp egl2 expression element with a promoter and a terminator, and then clone the expression element into the commercial plasmid pMD19- In the T vector, single clones were picked for sequencing, and the plasmid with correct sequencing was named pTeg2. For the plasmid map, see figure 1 As shown in A. β-glucosidase expression vector pTHB (Zhang et al., Bioresource Technology. 2010, 101, 9815–18), see the plasmid map figure 1 Shown in B.

[0037] The specific sequences of the above-mentioned primer pairs are as follows:

[0038] EG2-1524UF:GACAAGAAATCGGGTGTTTAGGT;

[0039] EG2-1813DR: ATAAGAATGCGGCCGCGTGGGCTGGGTAGGGTTTG.

Embodiment 2

[0040] Example 2. Using expression vectors pTeg2 and pTHB to transform Trichoderma reesei QM9414 to construct high-secretion genetically engineered bacteria for endoglucanase 2 and β-glucosidase

[0041] Genetic transformation of Trichoderma reesei QM9414 was performed using PEG / CaCl 2 mediated protoplast transformation method, pyrithione resistance gene ptrA and hygromycin B resistance gene hph as selectable markers. The purified 10 μg pTeg2 plasmid and 1 μg plasmid PAN7-1 (Punt et al., Gene.1987,56,117-24.) containing the hph resistance gene were mixed and co-transformed the protoplasts of Trichoderma reesei QM9414; the purified 10 μg of pTHB plasmid and 1 μg of pME2892 plasmid containing ptrA expression cassette (Krappmann et al., Eukaryotic Cell. 2005, 4, 1298–1307.) were mixed and co-transformed into QM9414 protoplasts.

[0042] The above PEG / CaCl 2 The specific method of mediated protoplast transformation is as follows:

[0043] (1) Preparation of Trichoderma reesei Q...

Embodiment 3

[0059] Example 3. Enzyme activity plate analysis of endoglucanase and β-glucosidase dual hypersecretion engineering strains:

[0060] With the engineering strain QMEB5 obtained in Example 2 and the starting strain QM9414, the enzyme activity of the transformed strain is detected by using the endoglucanase activity plate and the β-glucosidase activity plate detection method. The specific method is: take the spores of the transformed strain and inoculate Put it on a CMC plate, culture at 30°C for 3 days, stain with 1mg / mL Congo red solution for 15min, add an appropriate amount of 1M NaCl solution to wash and decolorize for 30min, discard the decolorizing solution, and observe the size of the hydrolysis circle. Such as image 3 As shown in A, the obvious hydrolysis circle around the colony of the transformant QMEB5 was significantly larger than that of the starting strain, indicating that the pTeg2 expression cassette was successfully integrated into the genome and the endoglucan...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a trichoderma reesei engineering bacterium high in secretion of endoglucanase and beta-glucosidases. The trichoderma reesei engineering bacterium is named as trichoderma reesei(Trichoderma reesei) QMEB5, the genotype of the bacterial strain is QM9414 delta Eegl2 delta Ebgl1, trichoderma reesei QM9414 is used as an original strain, the expression vector pTeg2 of a fusion gene of a gene expression box containing endoglucanase 2 is transformed, then the plasmid pTHB of a gene expression box containing beta-glucosidases is transformed, and screening and verifying are performed, so that the trichoderma reesei engineering bacterium is obtained. The invention further discloses an application of the engineering strain to fermentation production of cellulases. The experiment confirms that the egl2 expression quantity of the engineering strain is 27 times higher than that of the original strain, the bgl1 expression quantity of the engineering strain is 410 times higher than that of the original strain, the activity of the endoglucanase is 117.5IU / mL, and the activity of the beta-glucosidases is 34.5IU / mL. The cellulase system produced through fermentation can be efficiently applied to degradation of corn cobs and other lignocellulolyticenzyme materials, and has favorable industrial development and application prospects.

Description

technical field [0001] The invention relates to a Trichoderma reesei genetic engineering bacterium with high secretion of endoglucanase and β-glucosidase, its construction method and application, and belongs to the technical field of genetic engineering. Background technique [0002] Biomass is the most abundant renewable resource on earth. Enzymatic hydrolysis of complex biomass into fermentable sugars for conversion into biofuels and chemicals has become an effective way to overcome the energy crisis. However, the high enzyme cost of cellulase restricts the large-scale industrial production of cellulosic energy. Low production efficiency of cellulase, low enzyme specific activity and unsuitable ratio of enzyme components are the main factors for the high cost of enzymes. Therefore, in order to solve this bottleneck problem, on the one hand, it is necessary to improve the cellulase production capacity of the strain from the perspective of the strain itself; on the other h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/15C12N15/80C12N15/56C12P19/14C12P19/02
Inventor钟耀华钟立霞钱远超
OwnerSHANDONG UNIV