Check patentability & draft patents in minutes with Patsnap Eureka AI!

Candida categorized detection primer and probe composition, kit, detection method and application of composition

A detection probe and primer probe technology, applied in the biological field, can solve the problems of inability to distinguish bacterial species and candida typing, achieve consistent amplification efficiency, improve detection specificity and sensitivity, and achieve high sensitivity

Active Publication Date: 2019-07-05
DYNAMIKER BIOTECH TIANJIN
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the invention cannot distinguish the specific bacterial species corresponding to the positive samples, that is, it cannot type Candida

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Candida categorized detection primer and probe composition, kit, detection method and application of composition
  • Candida categorized detection primer and probe composition, kit, detection method and application of composition
  • Candida categorized detection primer and probe composition, kit, detection method and application of composition

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0083] The assembly of embodiment 1 kit

[0084] The nucleotide sequences of specific primers, detection probes and complementary probes for Candida albicans, Candida tropicalis, Candida parapsilosis, Candida krusei and Candida glabrata are shown in Table 1.

[0085] Table 1

[0086] Primer name Number SEQ ID NO. Nucleotide sequence 5'-3' Candida albicans upstream primer 1 TGTTTGAGCGTCGTTTCT Candida albicans downstream primers 2 AAGTTCAGCGGGTAGTCC Candida tropicalis upstream primer 3 GCCTGTTTGAGCGTCGTTTC Candida tropicalis downstream primers 4 CGCCTTACCACTACCGTCTT Candida parapsilosis upstream primer 5 CTGTTTGAGCGTCGTTTCT Candida parapsilosis downstream primer 6 TAAGTTCAGCGGGTAGTCC Candida krusei upstream primer 7 AGTACTACACTGCGTGAGCG Candida krusei downstream primers 8 TGCGAGAACCAAGAGATCCG Candida glabrata upstream primer 9 AACGCAGCGAAATGCGATAC Candida glabrata downstream primers 10 G...

Embodiment 2

[0102] The classification detection of embodiment 2 Candida

[0103] Adopt the kit among the embodiment 1 to carry out Candida classification detection, comprise the steps:

[0104] (1) extract sample DNA;

[0105] (2) Add Taq enzyme, dNTP, MgCl to step (1) sample DNA 2 , DMSO, buffer, specific primers, detection probes and complementary probes for five kinds of Candida, according to the preparation system in Table 2;

[0106] Table 2

[0107] components dose Taq Polymerase 2U dNTP 2M Primers (5 pairs) 200nM*10 Probes (5 pieces) 100nM*5 MgCl 2

3mM template 1μL DMSO 5% Total 25 μL

[0108] (3) Put the system in step (2) into a real-time fluorescent PCR instrument to perform PCR amplification reaction. The specific conditions are as follows:

[0109] (1") Preheat at 50°C for 2 minutes, 1 cycle;

[0110] (2") Pre-denaturation at 95°C for 10 minutes, 1 cycle;

[0111] (3") Denaturation at 95°C for 10s, ...

Embodiment 3

[0126] Embodiment 3 specific detection analysis

[0127] Extract Cryptococcus neoformans, Cryptococcus gattii, Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus, Aspergillus niger, Aspergillus nidulans, Aspergillus versicolor, S. The DNA of Bordetella pertussis, Haemophilus influenzae, Pseudomonas aeruginosa, Staphylococcus aureus, and Streptococcus pneumoniae were detected using the kit of Example 1 of the present invention and the method of Example 2. The results are shown in Table 4 below.

[0128] Table 4

[0129] strain name Detection of Ct value Detection of Tm value Cryptococcus neoformans - - Cryptococcus gattii - - Aspergillus fumigatus - - Aspergillus flavus - - Aspergillus terreus - - Aspergillus niger - - Aspergillus nidulans - - Aspergillus versicolor - - Saccharomyces cerevisiae - - Penicillium marneffei - - candida portuguese - - Candida guilderii - - ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
percent by volumeaaaaaaaaaa
Login to View More

Abstract

The invention provides a Candida categorized detection primer and probe composition, a kit, a detection method and an application of the composition. The Candida categorized detection primer and probecomposition comprises specific primers, detection probes and complementary probes which are used for Candida albicans, Candida tropicalis, Candida parapsilosis, Candida krusei and Candida glabrata, and the complementary probes and the detection probes are incompletely complemented and paired. The primer and probe composition can detect and determine presence and absence of Candida infection onceand can distinguish the Candida albicans, the Candida tropicalis, the Candida parapsilosis, the Candida krusei and the Candida glabrata in the same fluorescent light channel.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a combination of primers and probes, a kit, a detection method and an application thereof for the detection of Candida species, in particular to Candida albicans, Candida tropicalis, Candida parapsilosis, and Candida krusei Primer probe combinations, kits, detection methods and applications for the detection of Candida glabrata and Candida glabrata. Background technique [0002] Candida is one of the most common opportunistic pathogens in fungi, mainly including Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis and Candida krusei, which account for 80% of clinical samples. %above. Candida often parasitizes on human skin, oral cavity, vagina, and intestinal mucosa. When the body's immune function declines, it is easy to cause candidiasis. Because the culture method takes a long time to distinguish different Candida species, it is not conducive to rapid treat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12Q1/04C12N15/11C12Q1/686
CPCC12Q1/6895C12Q1/686C12Q2563/107C12Q2561/113Y02A50/30
Inventor 王志贤阎香言盛长忠周泽奇粟艳
Owner DYNAMIKER BIOTECH TIANJIN
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More