Candida categorized detection primer and probe composition, kit, detection method and application of composition
A detection probe and primer probe technology, applied in the biological field, can solve the problems of inability to distinguish bacterial species and candida typing, achieve consistent amplification efficiency, improve detection specificity and sensitivity, and achieve high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0083] The assembly of embodiment 1 kit
[0084] The nucleotide sequences of specific primers, detection probes and complementary probes for Candida albicans, Candida tropicalis, Candida parapsilosis, Candida krusei and Candida glabrata are shown in Table 1.
[0085] Table 1
[0086] Primer name Number SEQ ID NO. Nucleotide sequence 5'-3' Candida albicans upstream primer 1 TGTTTGAGCGTCGTTTCT Candida albicans downstream primers 2 AAGTTCAGCGGGTAGTCC Candida tropicalis upstream primer 3 GCCTGTTTGAGCGTCGTTTC Candida tropicalis downstream primers 4 CGCCTTACCACTACCGTCTT Candida parapsilosis upstream primer 5 CTGTTTGAGCGTCGTTTCT Candida parapsilosis downstream primer 6 TAAGTTCAGCGGGTAGTCC Candida krusei upstream primer 7 AGTACTACACTGCGTGAGCG Candida krusei downstream primers 8 TGCGAGAACCAAGAGATCCG Candida glabrata upstream primer 9 AACGCAGCGAAATGCGATAC Candida glabrata downstream primers 10 G...
Embodiment 2
[0102] The classification detection of embodiment 2 Candida
[0103] Adopt the kit among the embodiment 1 to carry out Candida classification detection, comprise the steps:
[0104] (1) extract sample DNA;
[0105] (2) Add Taq enzyme, dNTP, MgCl to step (1) sample DNA 2 , DMSO, buffer, specific primers, detection probes and complementary probes for five kinds of Candida, according to the preparation system in Table 2;
[0106] Table 2
[0107] components dose Taq Polymerase 2U dNTP 2M Primers (5 pairs) 200nM*10 Probes (5 pieces) 100nM*5 MgCl 2
3mM template 1μL DMSO 5% Total 25 μL
[0108] (3) Put the system in step (2) into a real-time fluorescent PCR instrument to perform PCR amplification reaction. The specific conditions are as follows:
[0109] (1") Preheat at 50°C for 2 minutes, 1 cycle;
[0110] (2") Pre-denaturation at 95°C for 10 minutes, 1 cycle;
[0111] (3") Denaturation at 95°C for 10s, ...
Embodiment 3
[0126] Embodiment 3 specific detection analysis
[0127] Extract Cryptococcus neoformans, Cryptococcus gattii, Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus, Aspergillus niger, Aspergillus nidulans, Aspergillus versicolor, S. The DNA of Bordetella pertussis, Haemophilus influenzae, Pseudomonas aeruginosa, Staphylococcus aureus, and Streptococcus pneumoniae were detected using the kit of Example 1 of the present invention and the method of Example 2. The results are shown in Table 4 below.
[0128] Table 4
[0129] strain name Detection of Ct value Detection of Tm value Cryptococcus neoformans - - Cryptococcus gattii - - Aspergillus fumigatus - - Aspergillus flavus - - Aspergillus terreus - - Aspergillus niger - - Aspergillus nidulans - - Aspergillus versicolor - - Saccharomyces cerevisiae - - Penicillium marneffei - - candida portuguese - - Candida guilderii - - ...
PUM
Property | Measurement | Unit |
---|---|---|
percent by volume | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap