Unlock instant, AI-driven research and patent intelligence for your innovation.

A Mutant of Multicopper Oxidase with Improved Salt Tolerance

A multi-copper oxidase and mutant technology, which is applied in the field of bioengineering, can solve the problems of worrying about the safety of adding strains, reducing protein content, and affecting food flavor.

Active Publication Date: 2020-12-29
JIANGNAN UNIV
View PDF15 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the control of the content of biogenic amines in food mainly starts from three aspects: (1) Control from the source: ①Most of the biogenic amines in food are formed through amino decarboxylation, and controlling the content of free amino acids can reduce the content of biogenic amines However, free amino acids in food are mainly the products of protein hydrolysis in raw materials. Controlling the content of free amino acids means reducing the protein content, which will affect the flavor of some high-protein foods; ② use amino acid decarboxylase-free The strain replaces the original production strain and is added to the fermentation system at the beginning of fermentation. However, due to the variety of original production strains and complex relationships in mixed fermentation and open fermentation, replacing one of the strains may cause changes in the entire fermentation system. Eventually lead to fermentation failure, so this control method is generally only suitable for closed single-bacteria fermentation systems
(2) Process control: ① Through reasonable selection of raw materials, temperature and salinity in the production process, the growth of bacteria producing biogenic amines can be inhibited to achieve the purpose of inhibiting the production of biogenic amines; the limitation of this method lies in the processing temperature and Factors such as salinity are mostly determined by food characteristics, and low-temperature storage will increase equipment and energy consumption costs, and some microorganisms can also produce biogenic amines at low temperatures; In the case of the dominant strain used for production, the biogenic amines produced during the fermentation process are degraded, however, the limitation of this method is that there are concerns about the safety of the added strain and the possible impact on the flavor of the food
Amine oxidase and histamine dehydrogenase that can degrade biogenic amines can only specifically act on one or several kinds of biogenic amines, and the enzyme activity is also inhibited by ethanol or carbonyl compounds. At the same time, the optimal pH of the enzyme Most of them are neutral, so when these two types of enzymes are used to degrade biogenic amines in alcoholic fermented drinks and acidic fermented foods, it is difficult to achieve ideal results
Multi-copper oxidase can catalyze the oxidation of various biogenic amines to generate corresponding aldehydes, ammonia and water, and its activity is less affected by acidic environment and ethanol. It will quickly inactivate the enzyme and affect the degradation effect of the enzyme on biogenic amines

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Mutant of Multicopper Oxidase with Improved Salt Tolerance
  • A Mutant of Multicopper Oxidase with Improved Salt Tolerance
  • A Mutant of Multicopper Oxidase with Improved Salt Tolerance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1: Recombinant bacteria construction

[0031] Select the plasmid pET28a(+) with the T7 promoter as the expression vector, and the pET28a(+) plasmid and the amplified GenBank number is CP011252.1 The indicated mcob gene encoding the unmutated multicopper oxidase (in GenBank number is CP011252.1 The nucleotide sequence shown is followed by the histidine-encoding sequence (CATCATCACCACCACCACTAA) for EcoRI and HindIII double enzyme digestion respectively. After the digestion products are gel-cut and recovered, they are ligated overnight with DNA ligase Solution I, and the ligated products are transformed into large intestine Bacillus JM109 competent cells were cultured at 37°C for 10 hours, and positive transformants were identified by colony PCR.

[0032] Pick 3 positive transformants, inoculate them in liquid LB medium (containing 50 μg / ml kanamycin), culture them at 37°C for 10 hours, extract the plasmids for sequencing verification, and transform the pla...

Embodiment 2

[0033] Embodiment 2: Preparation of mutant T317N-L386Y

[0034] (1) Preparation of mutant T317N

[0035] According to the multi-copper oxidase gene sequence of B. amyloliquefaciens, design and synthesize the primers for introducing T317N mutation, use the rapid PCR technology, and use the expression vector pET28a(+)-MCOB as a template,

[0036] The site-directed mutagenesis primers for introducing the T317N mutation are:

[0037] Upstream primer: 5'-TTTTA AAC AACGGCACCGGCTG-3' (the underline is the mutated base)

[0038] Downstream primer: 5'-GTGCCGTT GTT TAAAATAATATGTTTCTCCG-3' (the underline is the mutated base)

[0039] PCR reaction system: 2 x PrimerSTAR DNA polymerase 25 μL, upstream primer (10 μM) 1 μL, downstream primer (10 μM) 1 μL, template DNA 1 μL, ddH 2 O 22 μL.

[0040] The PCR amplification conditions were: pre-denaturation at 95°C for 3 minutes; followed by 30 cycles (98°C for 30 s, 55°C for 30 s, and 72°C for 7 min); and extension at 72°C for 10 minutes. ...

Embodiment 3

[0050] Example 3: Preparation of mutant T317N-L386Y-S427E

[0051] According to the gene sequence of the multi-copper oxidase of B. amyloliquefaciens, the primers for introducing the S427E mutation were designed and synthesized, and the rapid PCR technology was used to take the vector carrying the gene encoding the mutant T317N-L386Y as a template,

[0052] The site-directed mutagenesis primers for introducing the S427E mutation are:

[0053] Upstream primer: 5'-CACCTGCACTTGGTT GAG TTCCAAGTCCTTGACCGG-3' (the underline is the mutated base)

[0054] Downstream primer: 5'-CAAGGACTTGGAA CTC AACCAAGTGCAGGTGTATCGG-3' (the underline is the mutated base)

[0055] PCR reaction system: 2 x PrimerSTAR DNA polymerase 25 μL, upstream primer (10 μM) 1 μL, downstream primer (10 μM) 1 μL, template DNA 1 μL, ddH 2 O 22 μL.

[0056] The PCR amplification conditions were: pre-denaturation at 95°C for 3 minutes; followed by 30 cycles (98°C for 30 s, 55°C for 30 s, and 72°C for 7 min); and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a multi-copper oxidase mutant with improved salt tolerance. The present invention mutates the 317th threonine into asparagine, the 386th leucine into tyrosine, and the 427th serine into glutamic acid in the wild-type multi-copper oxidase WT by site-directed mutation, forming Mutant T317N‑L386Y‑S427E. Compared with WT, T317N‑L386Y‑S427E had improved tolerance to 6%, 9%, 12%, 15%, and 18% NaCl (W / V).

Description

technical field [0001] The invention relates to a multi-copper oxidase mutant with improved salt tolerance, in particular to a multi-copper oxidase mutant derived from Bacillus amyloliquefaciens with improved salt tolerance, and belongs to the technical field of bioengineering. Background technique [0002] Biogenic amine is a general term for a class of biologically active low-molecular-weight nitrogen-containing organic compounds, which are normal physiologically active substances in living organisms. The appropriate amount of biogenic amines synthesized by the human body can help maintain the normal physiological functions of the body. However, excessive intake of biogenic amines through food can cause allergic reactions such as headache, nausea, heart palpitations, changes in blood pressure, and respiratory disorders, which can be life-threatening in severe cases. . [0003] Biogenic amines are widely found in fermented foods rich in protein, such as dairy products, aqu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/02C12N15/53C12N15/70C12N1/21A23L5/20A23L27/50
CPCA23L5/25A23L27/50C12N9/0061C12N9/0063C12N9/0091C12N15/70C12Y110/03002C12Y110/03003C12Y116/03001C12N9/0004C12N15/52
Inventor 方芳周景文杨涛徐洁陈坚堵国成
Owner JIANGNAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More