The application of rgs1 gene as a negative regulator in improving the resistance of tomato bacterial leaf spot under low light environment
A technology of bacterial leaf spot and negative regulatory factors, applied in the fields of application, genetic engineering, angiosperms/flowering plants, etc., can solve problems such as decline in control effect, threat to health, consumption of large manpower, material resources, and funds, etc., to achieve Reduce the degree of occurrence, increase resistance, and increase the effect of resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1 Construction of CRISPR / Cas9 vector containing specific sgRNA
[0036] Find the DNA sequence of RGS1 (Solyc05g014160) on the PGSB website http: / / pgsb.helmholtz-muenchen.de / plant / tomato / , its sequence is shown in SEQ ID NO.1, enter http: / / crispr.hzau.edu .cn / cgi-bin / CRISPR2 / CRISPR website, find out the 20bp base sequence TCAGAAAGAGACATTGGTGG (SEQ ID NO.4) located in front of a PAM structure in the protein coding region with high onscore score and GC content >40%.
[0037] Design CRISPR primers as follows:
[0038] CRISPR front primer (SEQ ID NO.5): GATTGTCAGAAAGAGACATTGGTGG;
[0039] Post CRISPR primer (SEQ ID NO.6): AAACCCACCAATGTCTCTTTTCTGAC;
[0040] Take 5 μl each of the front and back primers of the above CRISPR, mix well, and anneal with a PCR machine to form double strands. The intermediate vector pMD18-T was cleaved with BbsI, purified with a common DNA purification kit, then ligated with the vector with T4 ligase, and ligated overnight at 16°C. Heat...
Embodiment 2
[0043] Example 2 Preparation and Identification of RGS1 Gene Mutant Materials
[0044] The sterilized seeds were sown in the medium, and the cotyledons were cut after 7 days. Agrobacterium infection method transforms the final plasmid prepared in Example 1 into the cotyledon, utilizes the totipotency of the plant cell, the cotyledon grows into a complete plant, and obtains T 0 Generation of gene-edited tomato material.
[0045] T 0 Detection of gene-edited tomato seedlings. Extraction of T by CTAB method 0 The genomic DNA of the generation plant was used as a template, and the following primers were designed at about 200 bp before and after the DNA sequence containing sgRNA, and PCR amplification and sequencing were performed for verification:
[0046] Primer before verification (SEQ ID No.8): TTTTAAGTGCATCGGTGAC
[0047] Primer before verification (SEQ ID No.9): GACTGGAAAGCAAGGAGG
[0048] The resulting PCR products were sent to a sequencing company for sequencing. Use...
Embodiment 3
[0052] Example 3 Research on the disease resistance of RGS1 gene editing mutants under normal light and low light environment
[0053] The bacterial leaf spot pathogenic bacteria were inoculated on King’s B solid medium containing 25 mg / L rifampicin, and cultured in an incubator at 28°C for 2 days to activate the bacteria as the original plate. Pick the colony from the original plate, plate it on the new King’s B medium, and culture it in the incubator at 28°C for 1 day. with 10mM MgCl 2 The solution suspends the bacterial liquid and adjusts the OD 600 = 0.1. Add 0.02% organic silicon and spray it on the back of the tomato plant leaves to allow the bacterial solution to infiltrate the leaves. Place the plants at a temperature of 25°C, relative air humidity of 95%, light and dark times of 12 hours each, and a light intensity of 450umol m -2 the s -1 (normal light) and light intensity 50umol m -2 the s -1 After cultivating for 3 days in an environment with little light, o...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More