Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Alpha-amyrin synthetase gene EjAAS1 and application thereof

A kind of aroma tree essence, synthetic enzyme technology, applied in application, genetic engineering, plant genetic improvement and other directions

Active Publication Date: 2020-03-31
SOUTH CHINA AGRI UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

α-Argentin is the direct precursor of the main triterpenoid components such as ursolic acid in loquat leaves, and its synthesis is the key enzyme for the synthesis of triterpenoids of cucurbitin, but there is no gene report for the synthesis of this catalytic enzyme in loquat

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alpha-amyrin synthetase gene EjAAS1 and application thereof
  • Alpha-amyrin synthetase gene EjAAS1 and application thereof
  • Alpha-amyrin synthetase gene EjAAS1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Cloning of Loquat EjAAS1 Gene cDNA Sequence

[0034] 1. Experimental method

[0035] 1. Sample collection

[0036] The leaf samples of "Zaozhong No. 6" during the five developmental stages of loquat were collected from the "Zaozhong No. 6" production tree planted in the loquat germplasm resource nursery of South China Agricultural University. Fresh samples were quickly frozen in liquid nitrogen and stored in a refrigerator at -80°C.

[0037] 2. RNA extraction

[0038] Use EASYspin Plus Plant RNA Rapid Extraction Kit (Adelaide) to extract RNA from the ground fruit samples according to the instructions. The specifics are as follows: Take 1.0mL RLT lysate into a 1.5mL centrifuge tube, and add 100mg of ground fruit sample powder , Shake vigorously for 20s, then lyse at 55°C for 20min; centrifuge the lysate at 13000rpm for 5-10min; take the supernatant, transfer to a new centrifuge tube, and add half of the supernatant volume of absolute ethanol, gently pipette to mix ; A...

Embodiment 2

[0052] Example 2 Comparison of triterpene acid content in different tissues of loquat and analysis of EjAAS1 expression pattern

[0053] 1. Experimental method

[0054] Each loquat tissue sample was collected according to the method in Example 1, RNA was extracted and cDNA was synthesized. EjACT was used as an internal reference (forward: CTTTCCCTCTATGCCAGTG and reverse: CAAGGTCAAGCCTCAAGAT) to analyze the expression of EjAAS1 in various tissues and different developmental stages (quantitative primer pair: forward: CAGCTCAAGACAGTACAAATTTAGT; reverse: CAATTGGCCGTTCATT AACAC). Using cDNA of each period as a template, use iTaqTM universal GreenSupermix (Bio-Rad), qPCR reaction was performed on the LightCycler 480 (Roche) fluorescent quantitative PCR machine. Amplify EjACT as an internal reference gene for loquat gene expression to normalize gene expression. 10.0μl mixed solution is 95℃60s; 95℃10s, 60℃20s, 72℃15s, repeated 39 times; the dissolution curve is analyzed according to the...

Embodiment 3

[0058] Example 3 Construction of EjAAS1 gene transient vector and transient transformation of tobacco leaves

[0059] 1. Experimental method

[0060] EjAAS1 was subcloned into 62SK transient expression vector with cgctctagaactagtggatcc (BamH I) ATGTGGAAGATCAAGTTTGGAGAGG and gataagcttgatatcgaattc (EcoRI) TCAAGCGATCTTTTTGATAGGCA primer pair. The specific vector construction is: using Gibson Master Mix and corresponding endonucleases (BamH I and EcoR I, purchased from New England Bio labs) were incubated at 37°C for 1 hour to linearize the 62SK vector. The digested product was purified using Gel DNA Mini Recovery Kit (Magen). Use ClonExpress one-step directional cloning seamless cloning kit to connect the purified enzyme digestion product to the target vector. The reaction system contains 1μl purified and recovered PCR amplification product, 1μl linearized vector, 2μl 5×CE II buffer, 1μl Exnase TM II and 4μl sterile water. The reaction system was reacted at 37°C for half an hour ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an alpha-amyrin synthetase gene EjAAS1 and application thereof and specially discloses application of an encoding gene with a nucleotide sequence as shown in SEQ ID NO.1 as a loquat alpha-amyrin synthetase gene and an application of protein with an amino acid sequence as shown in SEQ ID NO.2 as loquat alpha-amyrin synthetase. According to the invention, a fact that the alpha-amyrin synthetase gene EjAAS1 of which the expression changes in different tissues are significantly positively correlated with the content of triterpene acid is demonstrated for the first time; thegene is transiently expressed in tobacco leaves and the alpha-myrcidin can be heterologously synthesized in the tobacco leaves; and thus synthesis of loquat alpha-amyrin and in-vitro biosynthesis ofalpha-amyrin and a derivative ursoside glycoside triterpene acid can be promoted. A foundation is laid for application of synthetic biological methods such as gene tandem expression and biological generators in loquat metabolism research and a theoretical support is provided for modification and utilization of functional components.

Description

Technical field [0001] The present invention relates to the field of biotechnology, and more specifically, to an α-aroma synthase gene EjAAS1 and its application. Background technique [0002] Loquat has sprouts in autumn and winter flowers, spring and summer ripening. In addition to the fruits being popular with consumers as valuable fruits, its leaves are important traditional Chinese medicines and important triterpene acid product extraction substrates. For a long time, researchers have identified more than 30 triterpene acid components from loquat leaf extracts through improved extraction technology, mass spectrometry detection, and germplasm resource evaluation, and discovered that ursolic acid and its derivatives, corosolic acid, polin Ursuside triterpene acids such as citrinic acid are the main triterpene acids accumulated in loquat leaves. At the same time, in recent years, research by multiple research groups at home and abroad including the applicant’s team found that ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/61C12N9/90
CPCC12N9/90C12Y504/9904
Inventor 苏文炳林顺权杨向晖龙婷
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products