Lipase mutant and application thereof in preparation of (S)-2-chlorophenylglycine methyl ester

A technology of chlorophenylglycine methyl ester and mutants, applied in the fields of application, enzyme, hydrolase, etc., can solve the problems of long reaction time, achieve high selectivity, improve selectivity reversal, and shorten reaction time

Active Publication Date: 2020-05-08
ZHEJIANG UNIV OF TECH
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are still few research reports on the direct resolution of 2-chlorophenylglycine methyl ester in the current patent literature. In 2009, Huang Chunxu and others studied the use of alkaline protease to split 2-chlorophenylglycine methyl ester. After 24 hours of reaction, they obtained (S)-2-chlorophenylglycine methyl ester with an ee value of 99.8%
In 2014, Xue Ping et al. used immobilized penicillin G acylase to split for 30 hours and obtained a product with an ee value of 97.1%, but there were still defects such as long reaction time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lipase mutant and application thereof in preparation of (S)-2-chlorophenylglycine methyl ester
  • Lipase mutant and application thereof in preparation of (S)-2-chlorophenylglycine methyl ester
  • Lipase mutant and application thereof in preparation of (S)-2-chlorophenylglycine methyl ester

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Construction of wild-type Candida antarctica lipase B engineering bacteria (E.coli Rosetta(DE3) / pET22b(+)-CALB-WT)

[0045] 1. Cloning of wild-type Candida antarctica lipase B (CALB) gene

[0046] Pichia pastoris (Z. Liu. Cloning, expression and characterization of a lipase gene from the Candida antarctica ZJB09193 and its application in biosynthesis of vitamin A esters. Microbiol. Res., 2012, 167, 452 ~460) was inoculated in YPD liquid medium and cultured overnight, the fermentation liquid was centrifuged in a 2 mL centrifuge tube at 3000 rpm / min for 5 min, the supernatant was discarded, and the bacteria were collected; the genome was extracted using a fungal extraction kit.

[0047] According to the CALB gene (SEQ ID NO.1), primer 1: TTACCTAGTGGTTCCGACCC and primer 2: AGGAGTAACAATTCCTGAACAGG were designed, and the extracted genome was used as a template for PCR reaction to clone the wild-type CALB gene. The reaction system was as follows:

[0048]

[004...

Embodiment 2

[0068] Example 2 Induced expression of wild-type Candida antarctica lipase B (CALB-WT)

[0069] Inoculate the engineered bacteria E.coli Rosetta(DE3) / pET22b(+)-CALB-WT obtained in Part 3 of Example 1 into LB liquid medium containing 100 μg / mL ampicillin and 20 μg / mL chloramphenicol at 37° C. Cultivate overnight, inoculate in fresh LB medium containing a final concentration of 100 μg / mL ampicillin and 20 μg / mL with an inoculum volume concentration of 1% (v / v), culture at 37 °C and 180 rpm for 3 h, and then add to the culture medium Add IPTG at a final concentration of 0.1 mM, incubate at 22°C for 12 hours, and centrifuge at 10,000 g at 4°C for 10 minutes to obtain the corresponding bacterial cells.

[0070] The cells obtained above produce corresponding proteins, which can be used to prepare crude enzyme solution, and asymmetrically hydrolyze racemic 2-chlorophenylglycine methyl ester.

Embodiment 3

[0071] Example 3 Wild-type Candida antarctica lipase B (CALB-WT) asymmetrically hydrolyzes 2-chlorophenylglycine methyl ester

[0072] Add 0.5 g of racemic 2-chlorophenylglycine methyl ester and 50 mL of pH 7.0, 0.2 M sodium phosphate buffer in the reaction flask, then add 10 g of thalline cells obtained in Example 2 and mix evenly. The concentration of racemic 2-chlorophenylglycine methyl ester was 10 g / L, and the reaction was carried out at 30° C. with a controlled rotation speed of 600 rpm / min for 24 hours, and the reaction was terminated.

[0073] The reaction solution after the reaction was finished was analyzed by HPLC, and the results are shown in Table 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a lipase mutant and application thereof in preparation of (S)-2-chlorophenylglycine methyl ester. The lipase mutant is obtained by mutating glutamine at the 157th site of an amino acid sequence shown in SEQ ID No. 2 into phenylalanine, mutating isoleucine at the 189th site into lysine and mutating valine at the 154th site into aspartic acid. According to the lipase mutant,through molecular docking and site-saturation mutagenesis, the lipase mutant which can obviously shorten asymmetric hydrolysis reaction time and has high resolution efficiency and high selectivity onR-type 2-chlorophenylglycine methyl ester is obtained by screening; after the mutant reacts for 12 hours, the yield of the (S)-2-chlorophenylglycine methyl ester reaches 72.81%, and the ee value is 95.24%; and compared with a wild type, the lipase mutant has the charactersitics that activity improvement and selective inversion are realized, and the reaction time is shortened.

Description

technical field [0001] The invention relates to the technical field of enzyme gene modification, in particular to a lipase mutant and its preparation of a single enantiomer (S)-2-chlorophenylglycine methyl by splitting (R,S)-2-chlorophenylglycine methyl ester application in esters. Background technique [0002] Candida antarctica is a yeast isolated from Antarctica, which can synthesize two different lipases, CALA and CALB. As early as 1994, people had successfully isolated these two lipases, and studied their amino acid sequence and three-dimensional structure, and found that Candida antarctica lipase B (CALB) has a total of 317 amino acids and a molecular weight of 33kDa. [0003] So far, CALB has been cloned and expressed in a large number of Aspergillus oryzae, Pichia pastoris, Saccharomyces cerevisiae and Escherichia coli by researchers, and has become a commercially widely used enzyme. However, the wild-type CALB still has certain defects, such as poor thermal stabi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/20C12N15/55C12N15/70C12N1/21C12P41/00C12P13/04C12R1/19
CPCC12N9/20C12N15/70C12P13/04C12P41/001C12Y301/01003
Inventor王亚军班善赟程峰翁春跃郑裕国
OwnerZHEJIANG UNIV OF TECH