Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene PeFBL3 for regulating and controlling development of adventitious roots of poplars and application of gene PeFBL3

A root development and gene technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of molecular mechanism understanding and lack of understanding

Active Publication Date: 2020-08-14
NANJING FORESTRY UNIV
View PDF11 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The formation of adventitious roots is a very complex biological process. Scholars at home and abroad have done a lot of research on its mechanism, but most of these works are concentrated in the fields of anatomy and physiology, and there is a lack of understanding of the molecular mechanism of adventitious roots.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene PeFBL3 for regulating and controlling development of adventitious roots of poplars and application of gene PeFBL3
  • Gene PeFBL3 for regulating and controlling development of adventitious roots of poplars and application of gene PeFBL3
  • Gene PeFBL3 for regulating and controlling development of adventitious roots of poplars and application of gene PeFBL3

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1: Clone PeFBL3 gene ORF

[0034] Using Populus Nanlin 895 cDNA as material, Oligo 7 software was used to design primers to amplify the ORF sequence of PeFBL3 gene. The high-fidelity PCR reaction system is shown in Table 1. Wherein, the primers include: forward primer: 5'ATGAATTATTTCCCTGATGAAG3'; reverse primer: 5'TAAAGTCCACACGAACTCTGG3'. Among them, the total RNA of Populus Nanlin 895 was extracted using RNAprepPure Plant Total RNA Extraction Kit (DP432) from Tiangen Biochemical Technology (Beijing) Co., Ltd. The cDNA was reverse transcribed by using the FastKing one-step method of Tiangen Biochemical Technology (Beijing) Co., Ltd. to remove the first-strand synthesis premix reagent (KR118) of the genomic cDNA.

[0035] Table 1 High-fidelity PCR reaction system

[0036]

[0037]

[0038] The reaction conditions are as follows: (1) Pre-denaturation at 94°C for 3min; (2) 94°C for 30s-60°C for 30s-72°C for 2min) x 38 cycles; (3) 72°C for 10min. The amp...

Embodiment 2

[0039] Example 2 Construction of p35S-pBI121-PeFBL3 vector

[0040] (1) A small amount of p2GW7.0-PeFBL3 entry vector was extracted by alkaline lysis; a small amount of 35S-pBI121-GUS expression vector was extracted by alkaline lysis; p2GW7.0-PeFBL3 entry vector and 35S-pBI121-GUS expression vector were used to ClonaseTMII Plus enzyme mix was connected, reacted at 25°C for 2 hours, added 0.5 μl of proteinase K, mixed gently, and placed at 37°C for 10 minutes to quench the enzyme to obtain the p35S-pBI121-PeFBL3 vector. The LR cloning reaction system is shown in Table 3.

[0041] Among them, the preparation steps of the p2GW7.0-PeFBL3 entry vector (BP clone) are as follows: the PeFBL3 obtained by PCR amplification in Example 1 is subjected to agarose gel electrophoresis, and a recovery kit (thin agarose gel DNA recovery kit, GK2043 -50, Shanghai Jierui Biological Engineering Co., Ltd.) to purify and recover the target product; mix the recovered target product with the entry ca...

Embodiment 3

[0049] Example 3 PeFBL3 gene regulates plant adventitious root development

[0050] By electric shock conversion method (Bio-Rad MicroPulser Bole electrotransfer instrument; electric shock cup: Bio-Rad Bole electric shock cup 1652086; electric shock conditions: output range 200-3000v, precision 10v, use voltage 2.5kv, time constant 1.0ms, precision 0.1ms, Use temperature: room temperature; resistance: rifampicin (Rifampicin Rif) The constructed p35S-pBI121-PeFBL3 was transformed into the Agrobacterium strain LBA4404 (Invitrogen), through the Agrobacterium-mediated technology (He Guangyuan. Plant Genetic Engineering Experiment Manual [M] . Beijing: Tsinghua University Press, 2007) PeFBL3 gene will be transferred into Populus montana. PeFBL3 transgenic plants were subcultured for about 4 weeks to observe the development of adventitious roots. The rooting speed of transgenic plants was significantly slower than that of non-transgenic plants, and the number of lateral roots was s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene PeFBL3 for regulating and controlling development of adventitious roots of poplars. The gene is derived from Nanlin 895 poplars. According to the method, the PeFBL3 geneis transferred into the populus tomentosa through an agrobacterium-mediated technology to obtain the transgenic Shanxin poplars, and the result of adventitious roots of the transgenic Shanxin poplarsshows that the rooting speed of the transgenic Shanxin poplars is obviously lower than that of a non-transgenic plant, the number of lateral roots is obviously reduced, and secondary lateral roots grow normally.

Description

technical field [0001] The invention relates to the field of plant genetic engineering, in particular to a gene PeFBL3 for regulating the development of adventitious roots of poplar and its application. Background technique [0002] The root is an important organ for the plant to absorb nutrients and water and support the above-ground part. The growth of the root system is directly related to the growth state of the plant. Because of its long growth cycle, forest trees are more suitable for asexual reproduction through cuttings. Cuttings are not only simple, efficient, and cheap, but also can maintain the excellent traits of the mother plant and bloom early. The growth of adventitious roots needs to be promoted in the process of vegetative propagation, so rooting traits play a key role in vegetative propagation and afforestation of forest trees, and are also the main reference indicators for identifying the adaptability and stress resistance of clones. [0003] Adventitious...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82C12N5/10A01H5/06
CPCC07K14/415C12N15/8205C12N15/8261
Inventor 陈英滕青云李爽爽王光萍刘传强何青青黄敏仁
Owner NANJING FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com