Gene PeFBL3 for regulating and controlling development of adventitious roots of poplars and application of gene PeFBL3
A root development and gene technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of molecular mechanism understanding and lack of understanding
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Embodiment 1: Clone PeFBL3 gene ORF
[0034] Using Populus Nanlin 895 cDNA as material, Oligo 7 software was used to design primers to amplify the ORF sequence of PeFBL3 gene. The high-fidelity PCR reaction system is shown in Table 1. Wherein, the primers include: forward primer: 5'ATGAATTATTTCCCTGATGAAG3'; reverse primer: 5'TAAAGTCCACACGAACTCTGG3'. Among them, the total RNA of Populus Nanlin 895 was extracted using RNAprepPure Plant Total RNA Extraction Kit (DP432) from Tiangen Biochemical Technology (Beijing) Co., Ltd. The cDNA was reverse transcribed by using the FastKing one-step method of Tiangen Biochemical Technology (Beijing) Co., Ltd. to remove the first-strand synthesis premix reagent (KR118) of the genomic cDNA.
[0035] Table 1 High-fidelity PCR reaction system
[0036]
[0037]
[0038] The reaction conditions are as follows: (1) Pre-denaturation at 94°C for 3min; (2) 94°C for 30s-60°C for 30s-72°C for 2min) x 38 cycles; (3) 72°C for 10min. The amp...
Embodiment 2
[0039] Example 2 Construction of p35S-pBI121-PeFBL3 vector
[0040] (1) A small amount of p2GW7.0-PeFBL3 entry vector was extracted by alkaline lysis; a small amount of 35S-pBI121-GUS expression vector was extracted by alkaline lysis; p2GW7.0-PeFBL3 entry vector and 35S-pBI121-GUS expression vector were used to ClonaseTMII Plus enzyme mix was connected, reacted at 25°C for 2 hours, added 0.5 μl of proteinase K, mixed gently, and placed at 37°C for 10 minutes to quench the enzyme to obtain the p35S-pBI121-PeFBL3 vector. The LR cloning reaction system is shown in Table 3.
[0041] Among them, the preparation steps of the p2GW7.0-PeFBL3 entry vector (BP clone) are as follows: the PeFBL3 obtained by PCR amplification in Example 1 is subjected to agarose gel electrophoresis, and a recovery kit (thin agarose gel DNA recovery kit, GK2043 -50, Shanghai Jierui Biological Engineering Co., Ltd.) to purify and recover the target product; mix the recovered target product with the entry ca...
Embodiment 3
[0049] Example 3 PeFBL3 gene regulates plant adventitious root development
[0050] By electric shock conversion method (Bio-Rad MicroPulser Bole electrotransfer instrument; electric shock cup: Bio-Rad Bole electric shock cup 1652086; electric shock conditions: output range 200-3000v, precision 10v, use voltage 2.5kv, time constant 1.0ms, precision 0.1ms, Use temperature: room temperature; resistance: rifampicin (Rifampicin Rif) The constructed p35S-pBI121-PeFBL3 was transformed into the Agrobacterium strain LBA4404 (Invitrogen), through the Agrobacterium-mediated technology (He Guangyuan. Plant Genetic Engineering Experiment Manual [M] . Beijing: Tsinghua University Press, 2007) PeFBL3 gene will be transferred into Populus montana. PeFBL3 transgenic plants were subcultured for about 4 weeks to observe the development of adventitious roots. The rooting speed of transgenic plants was significantly slower than that of non-transgenic plants, and the number of lateral roots was s...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com