Supercharge Your Innovation With Domain-Expert AI Agents!

A kind of prothrombin activator and rapid hemostatic material containing prothrombin activator

A technology of activating factors and prothrombin, which is applied in the field of medical biomaterials, can solve the problems of ineffective hemostasis, hemophiliacs who cannot quickly stop hemorrhage, and visceral hemorrhage, and achieve significant hemostatic effect, significant hemostatic effect, prevention of secondary bleeding and Effect of infection

Active Publication Date: 2021-05-11
BIOLOGY INST OF SHANDONG ACAD OF SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] In order to solve the problem that the existing hemostatic materials cannot quickly stop bleeding from internal organs, especially arterial bleeding, and cannot effectively stop bleeding from hemophiliacs, the purpose of the present invention is to provide a prothrombin activator and a prothrombin activator containing prothrombin activator hemostatic material

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of prothrombin activator and rapid hemostatic material containing prothrombin activator
  • A kind of prothrombin activator and rapid hemostatic material containing prothrombin activator
  • A kind of prothrombin activator and rapid hemostatic material containing prothrombin activator

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0051] The present invention also includes a preparation method of prothrombin activator, comprising the following steps:

[0052] ①Design primers according to the base sequence shown in SED ID NO: 1, and introduce restriction sites at the 5' end primers and 3' end primers respectively. The restriction site of the 5' end primers is Bam HI, 3' The enzyme cutting site of the end primer is Xho I;

[0053] The 5' end primer is GGATCCATGGCTCCTCAACTACTCCT;

[0054] The 3' end primer is CTCGAGTTGAATATATCACTTTTATTCTGTTCC;

[0055] ② Recovery of DNA fragments containing prothrombin activator;

[0056] Cut off the target fragment of the electrophoresis gel under ultraviolet light, put it into a small centrifuge tube, add 100 μL NaI solution (100 μg gel: 100 μL NaI), and then place it in a 55 ° C water bath to dissolve the gel; add 50 μL of glass powder to make DNA is adsorbed on the glass powder, so that the DNA is separated from the agarose gel, placed at 25°C for 15 minutes, and ce...

Embodiment 1

[0094] A prothrombin activator, the cDNA sequence of which is the base sequence shown in SED ID NO:1.

[0095] A preparation method of prothrombin activator, comprising the following steps:

[0096] ①Design primers according to the base sequence shown in SED ID NO: 1, and introduce restriction sites at the 5' end primers and 3' end primers respectively. The restriction site of the 5' end primers is Bam HI, 3' The enzyme cutting site of the end primer is Xho I;

[0097] The 5' end primer is GGATCCATGGCTCCTCAACTACTCCT;

[0098] The 3' end primer is CTCGAGTTGAATATATCACTTTTATTCTGTTCC;

[0099] ② Recovery of DNA fragments containing prothrombin activator;

[0100] Cut off the target fragment of the electrophoresis gel under ultraviolet light, put it into a small centrifuge tube, add 100 μL NaI solution (100 μg gel: 100 μL NaI), and then place it in a 55 ° C water bath to dissolve the gel; add 50 μL of glass powder to make DNA is adsorbed on the glass powder, so that the DNA is ...

Embodiment 2

[0125] Except for the following steps, all the other steps are the same as the steps of the preparation method of the prothrombin activator of Example 1, specifically:

[0126] The enzyme digestion time in step ③ is 3.5 hours, recover and purify the enzyme digestion product after 12 hours in step ⑤, incubate in a 30°C incubator for 3 hours, after the incubation is completed, spread the bacteria solution on the plate, and incubate it upside down at 30°C for 4 days to obtain single colony;

[0127] The pH of the medium in step ⑦ is 6.0, and the specific composition is to include 2% tryptone, 1% yeast extract, 1.34% yeast nitrogen base in parts by weight, 4×10 -5 D-vitamins, 1% glycerol, 100 mM phosphate buffer pH 6.0.

[0128] The specific steps of freeze-drying are as follows: pre-freeze the material in a vacuum freeze dryer at -60°C for 6 hours, and carry out sublimation drying at a vacuum of 5 Pa in the drying chamber at a temperature of 20°C for 10 hours. After sublimation,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a prothrombin activator and a rapid hemostatic material containing the prothrombin activator. The cDNA sequence of the prothrombin activator is the base sequence shown in SED ID NO: 1, which is an artificially synthesized Active enzyme, safe and non-toxic, can quickly activate prothrombin, and further form stable fibrin, so as to achieve the purpose of rapid hemostasis; the rapid hemostasis material of the present invention uses graphene oxide and polylactic acid as base materials, through Combining the substrate material with the prothrombin activator and calcium chloride in a non-covalent manner can maintain the activity and stability of the prothrombin activator to the greatest extent; among them, the graphene oxide material has a super strong adsorption effect and can Effectively absorb harmful substances of various molecular weights from the wound surface, including protein hydrolysis and thermal denaturation products, biogenic amines, inflammatory mediators and bacterial toxins, etc., which can reduce the inflammatory response and wound healing time.

Description

technical field [0001] The invention relates to the technical field of medical biological materials, in particular to a prothrombin activator and a rapid hemostatic material containing the prothrombin activator. Background technique [0002] Prothrombin activator is an effective additive factor for hemostatic materials. It can directly activate prothrombin to form thrombin and has a significant hemostatic effect. However, there are few studies on prothrombin activator at home and abroad, and there is no effective coagulation Enzyme activator. [0003] There are currently three types of hemostatic materials: the first type is to absorb the water in the blood near the wound through the physical or chemical action of the material, so that the coagulation components of the blood at the wound are concentrated and aggregated, thereby accelerating coagulation; The electrostatic interaction between red blood cells or platelets can improve the adhesion and aggregation ability of red...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/00C12N15/52C12N15/81C12N1/19A61L15/26A61L15/24A61L15/18A61L15/44A61L24/00A61L24/02A61L24/04A61L24/06D01F8/14D01F8/12D01F8/08D01F8/10D01F1/10C12R1/84
CPCA61L15/18A61L15/24A61L15/26A61L15/44A61L24/0015A61L24/02A61L24/046A61L24/06A61L2300/252A61L2300/418A61L2400/04C12N9/00C12N15/815D01F1/10D01F8/08D01F8/10D01F8/12D01F8/14C08L67/04C08L77/00C08L33/20C08L39/06
Inventor 刘可春靳梦王利振段秀英张姗姗李晓彬孙晨
Owner BIOLOGY INST OF SHANDONG ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More