Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for promoting over-expression of TSP4 in mesenchymal stem cells, and preparation and application of mesenchymal stem cells

A mesenchymal stem cell and overexpression technology, which is applied in the field of lentivirus-infected mesenchymal stem cell preparations, can solve the problems of slow formation of new blood vessels, low number of mesenchymal stem cells, poor treatment effect, etc., so as to improve the efficiency of angiogenesis and promote the Effects of paracrine function, enhancement of self-renewal and multi-directional differentiation and hyperproliferation

Inactive Publication Date: 2020-10-27
SHENZHEN LUOHU PEOPLELS HOSPITAL
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the embodiments of the present invention is to provide a method for promoting the overexpression of TSP4 in mesenchymal stem cells through lentiviral infection, aiming to solve the problem of mesenchymal stem cells in the human body due to the extremely small number, low survival rate, and slow formation of new blood vessels. Technical problems such as poor therapeutic effect in the application of ischemic disease drugs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for promoting over-expression of TSP4 in mesenchymal stem cells, and preparation and application of mesenchymal stem cells
  • Method for promoting over-expression of TSP4 in mesenchymal stem cells, and preparation and application of mesenchymal stem cells
  • Method for promoting over-expression of TSP4 in mesenchymal stem cells, and preparation and application of mesenchymal stem cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0096] A preparation method of Plv-Easy-GFP-TSP4 lentivirus.

[0097] (1) Using the snapgene software, design corresponding primers according to the sequence of the coding region (CDS region) of the plasmid pCMV6-Thbs4 gene: upstream: 5'CGGGATCCATGCCGGCCCCAC3'; downstream: 5'CCGCTCGAGATTATCCAAGCGGTC3'.

[0098] (2) Perform polymerase chain reaction amplification on the upper primers in the system shown in Table 4 below to obtain oligonucleotide chains.

[0099] Table 4

[0100]

[0101]

[0102] Wherein, the DNA template is the pCMV6-Thbs4 plasmid, and the extension rate is 15-30s / kb. After the PCR amplification reaction is completed, the gel is recovered and purified to obtain a purified DNA solution.

[0103] (3) In the system shown in Table 5 below, the pENTR11 plasmid vector was double-digested with XhoI and BamHI to obtain the pENTR11 plasmid vector with cohesive ends.

[0104] table 5

[0105]

[0106] (4) In the ligation reaction system of Table 6 below, the...

Embodiment 2

[0114] A method for culturing bone marrow mesenchymal stem cells (BMSCs).

[0115] (1) SD rats (50±10) g were killed by neck dislocation, soaked in 75% alcohol for 10 minutes.

[0116] (2) Isolate the rat femur under sterile conditions, cut off the femoral metaphysis, use a 5ml syringe to absorb DMEM / F12 complete medium (DMEM / F12+20%FBS+1% double antibody) and flush out the bone marrow to 10cm 2 In the cell culture dish, the cell suspension was made by blowing with a pipette gun.

[0117] (3) Transfer the above cell suspension into a 15ml centrifuge tube, label it, centrifuge at 800rpm*10min, and discard the supernatant. After resuspending the cells in DMEM / F12 complete medium, move the cell suspension to 25cm 2 culture flask at 37°C 95% CO 2 The cells were cultured in an incubator, and the medium was changed after 48 hours.

[0118] (4) When the cell density reaches above 80%, digest the cells with 0.25% trypsin and spread to 75cm 2 Cell culture flasks continued to grow....

Embodiment 3

[0123] A method for infecting bone marrow mesenchymal stem cells (TSP4-BMSC) with Plv-Easy-GFP-TSP4 lentivirus.

[0124] (1) Inoculate the bone marrow mesenchymal stem cells into a cell culture flask, and culture them in the medium of DMEM / F12+10% FBS+1% double antibody in a cell culture incubator at 37°C until the bone marrow mesenchyme The density of the stem cells is 80%, and the first culture product is obtained;

[0125] (2) replacing the medium of the first culture product with a medium comprising DMEM / F-12 and 5% FBS, and culturing at 37° C. for 2 hours to obtain a second culture product;

[0126] (3) replacing the medium of the second culture product with a lentivirus medium, and culturing at 37° C. for 6 hours to obtain a third culture product;

[0127] (4) The medium of the third culture product was replaced with a medium comprising DMEM / F-12, 5% FBS and 1‰GM, and cultured for 72 hours to obtain lentivirus-infected bone marrow mesenchymal stem cells (TSP4-BMSC ). ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and in particular relates to a method for promoting the over-expression of TSP4 in mesenchymal stem cells through lentivirus infection. The pENTR11-TSP4 expression plasmid is obtained through the pCMV6-Thbs4 plasmid and a pENTR11 plasmid vector; then the pENTR11-TSP4 expression plasmid and Plv-Easy-T plasmid are connected to obtain Plv-Easy-GFP-TSP4 lentiviral expression plasmid; then Plv-Easy-GFP-TSP4 lentivirus is obtained through packaging; and finally the Plv-Easy-GFP-TSP4 lentivirus is used to infect mesenchymal stem cells. Viral gene fragments are integrated into the genome of the mesenchymal stem cells to obtain TSP4-over-expressed mesenchymal stem cells, so that the activation efficiency of the TSP4-over-expressed mesenchymalstem cells for promoting angiogenesis is improved, and thereby the TSP4-over-expressed mesenchymal stem cells are applied in drugs for the treatment of ischemic diseases, and especially applied in drugs for the treatment of ischemic stroke.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for promoting the overexpression of TSP4 in mesenchymal stem cells through lentivirus infection, a lentivirus-infected mesenchymal stem cell preparation and application. Background technique [0002] Ischemic stroke refers to hemiplegia and disturbance of consciousness caused by cerebral infarction and cerebral artery blockage on the basis of cerebral thrombosis or cerebral thrombosis. Angiogenesis is very important for the prognosis of patients with ischemic stroke. After stroke, endogenous neural stem cells enter the ischemic injury area along the "track" of angiogenesis for nerve regeneration and repair. Angiogenesis, defined as the generation of new blood vessels from pre-existing ones, is a normal and crucial process in tissue growth and development. Re-establishment of functional vasculature is beneficial to promote stroke recovery. In the central nervous ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/867C12N5/10A61K35/28A61P9/10
CPCC12N15/86C12N5/0663C12N5/0668C12N5/0667A61K35/28A61P9/10C12N2740/15043C12N2800/107C12N2510/00
Inventor 张倩刘韬
Owner SHENZHEN LUOHU PEOPLELS HOSPITAL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More