Trehalose synthesis bifunctional enzyme coding gene TvTPS/TPP and application thereof
A bifunctional enzyme and coding gene technology, applied in the field of microorganisms, can solve the problems affecting the survival of Trichoderma, affecting the agricultural control effect and industrial production capacity, etc., and achieve the effect of improving the application effect.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0071] Embodiment 1: the cloning of Trichoderma viride TvTPS / TPP gene sequence and the construction of expression vector
[0072] (1) Cloning of TvGCN5 gene expression cassette
[0073] Genomic DNA of Trichoderma viride Tv-1511 was extracted according to the instructions of the fungal genome extraction kit (E.Z.N.A Fungal DNA Kit, OMEGA, USA).
[0074] Using genomic DNA as a template to amplify the complete sequence of the TvTPS / TPP gene expression cassette, the amplification primers are: TvTPS / TPP-FL-EcoRI-F: CGGAATTCATGGCGCGTTATGAGTCTCCTCT (SEQ ID NO.3) and TvTPS / TPP-FL-KpnI -R: GGGGTACCTCCACAACTCCTCCTCCGGAATGT (SEQ ID NO. 4).
[0075] Use the high-fidelity PCR polymerase master mix (2×Phanta Master Mix, Nanjing Nuoweizan) to carry out PCR amplification to obtain the TvTPS / TPP gene expression cassette with enzyme-cleaved junction sites (EcoRI and KpnI); 1% agarose gel electrophoresis to obtain a 2625bp DNA fragment ( figure 2 ); use the DNA recovery kit (FastPure Gel DNA...
Embodiment 2
[0083] Example 2: Protoplast preparation and construction of overexpressed engineered bacteria
[0084] (1) Protoplast preparation
[0085] Trichoderma viride Tv-1511 was inoculated on a PDA plate, and after culturing at 28°C for 10 days, a large amount of fresh conidia were produced; with 10mL of normal saline (0.9% NaCl, 0.05% Tween-20), the mycelial surface was washed, filtered through glass wool paper, Removing the mycelia to obtain a spore suspension;
[0086] Spread 200 μL of the spore suspension on a cellophane-covered PDA plate, and incubate at 28°C in the dark for 24 hours to germinate the spores on the PDA plate;
[0087] Preparation of lysing enzyme solution: Take 0.15 g of lysing enzyme (Lysing enzyme, Sigma: L1412) and dissolve it in 20 mL of solution I (1.2M D-sorbitol, 0.1M KH 2 PO 4 ,pH 5.6), 0.2μM membrane filter sterilization;
[0088] Take out the PDA plate, take out the fiber membrane with mycelia and stick it on the plate containing 3-4mL lysate, and t...
Embodiment 3
[0098] Embodiment 3: Analysis of Trichoderma viride original strain and TvTPS / TPP-OE engineered bacteria salt tolerance
[0099] Collection of sterile spores
[0100] Inoculate the original strain of Trichoderma viride and TvTPS / TPP-OE engineering bacteria on the PDA plate, and after cultivating for 10 days at 28°C, a large amount of fresh conidia were produced; the surface of the mycelia was washed with 10mL normal saline (0.9%NaCl, 0.05%Tween), and after Filter with glass wool paper, remove mycelia to obtain spore suspension; suspend with 30% glycerin, mix thoroughly, dispense into 1.5mL centrifuge tubes, mark the name and time, and freeze at -80°C; take a tube of spores Count the viable bacteria in the solution to determine the concentration of the spore solution.
[0101] Plate salt tolerance test
[0102] Activate the original strain of Trichoderma (Wildtype) and TvTPS / TPP-OE engineering bacteria on the PDA plate first, and culture them in the dark at 28°C for 48-72 hou...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com