Transaminase mutant and its application in the preparation of sitagliptin intermediate
A mutant and transaminase technology, applied in the field of recombinant genetically engineered bacteria and recombinant enzymes, can solve the problems of high conversion rate of raw materials, expensive catalyst, high yield, etc., and achieve the effect of high stereoselectivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1: Amplification of transaminase gene MbTA
[0029] According to the transaminase gene sequencing information from Mycolicibacterium included in Genbank, the total genomic DNA of the transaminase of Mycolicibacterium was extracted with a rapid nucleic acid extraction instrument, and the genomic DNA was used as a template, and primer 1 (ATGGGCATCGATACC), primer 2 (GTAGCAGATATCTTCGA) for PCR amplification. PCR reaction system (total volume 50 μL): 5 μL of 10×Pfu DNA Polymerase Buffer, 1 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP and dTTP), 1 μL of cloning primer 1 and primer 2 each at a concentration of 50 μM, 1 μL of genomic DNA , Pfu DNA Polymerase 1μL, nucleic acid-free water 40μL.
[0030] Using BioRad PCR instrument, PCR reaction conditions: pre-denaturation at 95°C for 5min, denaturation at 95°C for 30s, annealing at 65°C for 45s, extension at 72°C for 1min, a total of 30 cycles, and finally extension at 72°C for 10min.
[0031] The PCR reac...
Embodiment 2
[0032] Embodiment 2: Construction of recombinant Escherichia coli BL21 / pET28b-MbTA
[0033] Primer 3 (CCG) was designed according to the MbTA gene sequence in Example 1 GAATTC GGTATCGACACCGGTACCTC), primer 4 (TTGGG ATCCGT ACTGGATAGCTTCGATCAGC)), and EcoR I and BamH I restriction enzyme sites (underlined) were introduced into primer 3 and primer 4, respectively. Under the initiation of primer 3 and primer 4, high-fidelity Pfu DNA polymerase was used to amplify, and the recombinant plasmid pMD18-T-MbTA was used as a template (obtained in Example 1) to obtain the MbTA gene sequence. After sequencing, EcoR I and The amplified fragment was treated with BamH I restriction endonuclease (TaKaRa), and the fragment was ligated with the commercial vector pET28b (Invitrogen) treated with the same restriction endonuclease using T4 DNA ligase (TaKaRa) to construct Expression vector pET28b-MbTA. The constructed expression vector pET28b-MbTA was transformed into Escherichia coli BL21(DE3...
Embodiment 3
[0034] Example 3: Induced expression of aminotransferase (MbTA)
[0035] The recombinant Escherichia coli BL21(DE3) / pET28b-MbTA obtained in Example 2 was inoculated into LB liquid medium containing 50 μg / ml kanamycin resistance, cultivated at 37° C. for 12 hours at 200 rpm, and then treated with 1% (v / v) The inoculum is inoculated into fresh LB liquid medium containing 50 μg / ml kanamycin resistance, cultured at 37°C and 150 rpm until the OD 600 of the bacteria reaches 0.6-0.8, and the final concentration of 0.1 mM IPTG is added After induction culture at 28°C for 12h, centrifuge at 5000rpm at 4°C for 25min, discard the supernatant, collect the precipitate, and obtain the recombinant Escherichia coli BL21 / pET28b-MbTA wet cell containing the expression recombinant plasmid. The bacterium can be used directly as a biocatalyst or for protein purification.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
