Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

High-yield D-pantothenic acid genetically engineered bacterium and construction and application thereof

A technology of genetically engineered bacteria and pantothenic acid, which can be used in genetic engineering, application, plant genetic improvement, etc., and can solve the problems that cannot be produced with pantothenic acid derivatives

Active Publication Date: 2021-10-01
ZHEJIANG UNIV OF TECH
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the main production methods of pantothenic acid are as follows: (1) Physically induced crystallization method: the solubility of vortex calcium pantothenate is greater than that of D-type or L-type to induce crystallization. This method has mature technology, but it can only produce Calcium pantothenate, which cannot be used in the production of other pantothenic acid derivatives

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-yield D-pantothenic acid genetically engineered bacterium and construction and application thereof
  • High-yield D-pantothenic acid genetically engineered bacterium and construction and application thereof
  • High-yield D-pantothenic acid genetically engineered bacterium and construction and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: Preparation of E.coli DH5α Competent

[0039] Streak the E.coli DH5α stored at -80°C on an LB plate without anti-antibody, culture at 37°C for 12 hours, and grow a single colony. Pick a single colony and inoculate it in 10 mL of LB liquid medium, and then shake it at 37°C and 150 rpm for 12 hours. Transfer to 50mL LB liquid medium with 1% inoculum amount, then shake culture at 37°C and 150rpm for about 2h, when the culture OD 600 When it is close to 0.6-0.8, ice bath for more than 30min to stop the growth. Afterwards, the cells were collected by centrifugation at 5000 rpm for 5 min at 4°C, and the supernatant was discarded. Then add 20 mL of pre-cooled 0.1M CaCl 2 The solution was resuspended and placed in an ice bath for 30 min. Repeat centrifugation and addition of 0.1M CaCl 2 Solution resuspension operation. Collect the cells by centrifugation at 5000 rpm for 10 min at 4°C and discard the supernatant. Add 1 mL (per 50 mL of medium) of 0.1 M CaCl con...

Embodiment 2

[0040] Embodiment 2: Preparation of bacterial strain DPA-11 competent

[0041] The pTrc99A plasmid was purchased from Addgene Company, the product number is VT1294. The strain DPA-11 and the strain DPA-11-pTrc99A-panBpanC were constructed and preserved in the laboratory of the School of Bioengineering, Zhejiang University of Technology.

[0042] Strain DPA-11 Construction:

[0043] (1) Applying CRISPR-Cas9 gene editing technology to replace the promoters of panC, panB, panE and ilvC genes in the genome of E. coli W3110 with the trc promoter to obtain strain E. coli W3110 Trc-panCpanEpanBilvC;

[0044] (2) Applying CRISPR-Cas9 gene editing technology to repair the ilvG gene in the genome of the strain E.coli W3110 Trc-panCpanEpanBilvC to obtain the strain E.coli W3110 Trc-panCpanEpanBilvC / ilvG*;

[0045] (3) The avtA gene in the strain E.coli W3110 Trc-panCpanEpanBilvC / ilvG* was knocked out using CRISPR-Cas9 gene editing technology to obtain the strain E.coli W3110 Trc-panCpanE...

Embodiment 3

[0057] Example 3: Construction of a single mutation site library

[0058] The 3D model of panB derived from Corynebacterium glutamicum was constructed by Swiss-Model, and the model of KPHMT (panB) and the substrate small molecules α-ketoisovaleric acid and 5,10-methylene were connected using AutoDock molecular docking software Based on tetrahydrofolate for molecular docking, the key sites on the panB gene were selected for mutation. Design primers to construct single mutation site genetically engineered bacteria.

[0059] Primers were designed as follows:

[0060] E18A

[0061] Upstream primer 1: ACCCGTCATTTCCGCGCTGCTAAAGTAAACGGC

[0062] Downstream primer 2: AGCGCGGAAATGACGGGTGCGGATTTTCTTTGC

[0063] K20A

[0064] Upstream primer 3: CATTTCCGCGAAGCTGCTGTAAACGGCCAGAAA

[0065] Downstream primer 4: AGCAGCTTCGCGGAAATGACGGGTGCGGATTTT

[0066] V21E

[0067] Upstream primer 5: TTCCGCGAAGCTAAAGAGAACGGCCAGAAAGTT

[0068] Downstream primer 6: CTCTTTAGCTTCGCGGAAATGACGGGTGCGGAT ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
densityaaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of genetic engineering, in particular to a high-yield pantothenic acid genetically engineered bacterium, a construction method thereof and application of the high-yield pantothenic acid genetically engineered bacterium in preparation of pantothenic acid through microbial fermentation. According to the invention, the expression of the panB gene is enhanced by mutating the key site of the panB gene in the genome, so that the efficiency of producing pantothenic acid by a biological fermentation method is improved. A series of ketopantoic acid hydroxymethyltransferase mutant genetically engineered bacteria which obviously change the yield of pantothenic acid are obtained, the obtained ketopantoic acid hydroxymethyltransferase mutant genetically engineered bacteria are used for producing D-pantothenic acid through a fermentation method, and compared with an original genetically engineered strain, the yield of D-pantothenic acid produced by fermentation of the ketone pantoic acid hydroxymethyltransferase mutant genetically engineered bacterium constructed by the invention is improved, and the mutant genetically engineered bacterium has industrial development and application prospects.

Description

(1) Technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a high-yielding D-pantothenic acid genetically engineered bacterium and a construction method thereof, as well as its application in preparing D-pantothenic acid by microbial fermentation. (2) Background technology [0002] D-pantothenic acid, also known as pantothenic acid or vitamin B 5 , is a water-soluble vitamin, the chemical index number (CAS) of D-pantothenic acid is 79-83-4, the relative molecular mass is 219.23500, and the relative density is 1.266g / cm 3 , whose chemical formula is CH 2 OHC (CH 3 ) 2 CHOHCONHCH 2 CH 2 COOH, composed of pantothenic acid and beta-Ala. There is optical activity, and only D-type ([α]=+37.5°) has biological activity. Racemic pantothenic acid has hygroscopicity and electrostatic adsorption; pure free pantothenic acid is a light yellow viscous oil, acidic, soluble in water and ethanol, insoluble in benzene and chloroform, pan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/54C12P13/02C12R1/19
CPCC12N9/1014C12P13/02C12Y201/02011
Inventor 柳志强强煜蔡雪刘思琦张博郑裕国
Owner ZHEJIANG UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com