Vomitoxin specific nucleic acid aptamer and application thereof
A technology of nucleic acid aptamer and deoxynivalenol, applied in instruments, biochemical equipment and methods, analytical materials, etc., can solve the problems of high precision, low detection limit, high detection cost, etc., and achieve the effect of rapid detection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1 Screening of DON-specific nucleic acid aptamers
[0030] 1. In vitro chemical synthesis of initial random single-stranded DNA (ssDNA) library and primers, the sequence is as follows: 5'-ATCCAGAGTGACGCAGCA-40N-TGGACACGGTGGCTTAGT' (40N represents 40 random nucleotides)
[0031] Upstream primer: 5'-ATCCAGAGTGACGCAGCA-3'
[0032] 5' phosphorylation downstream primer: 5'-P-ACTAAGCCACCGTGTCCA-3'
[0033] The random ssDNA library and primers were prepared into 100 μM storage solution with TE buffer and stored at -20°C for later use.
[0034] 2. Acquisition and processing of targets used in screening
[0035] Take 5 mg of DON and add 1 mL of 50% N,N-dimethylformamide (DMF) to dissolve, so that the final concentration is 5 mg / ml. Then take two portions of sapharose 6B (agarose 6B), 0.2 g each. Add 500 μL DON solution to one portion and 500 μL 50% DMF to the other. Add 10 μL of 10M NaOH to two parts of sapharose 6B respectively. Incubate overnight at 30°C. Then w...
Embodiment 2
[0050] Example 2 Affinity evaluation of DON nucleic acid aptamers
[0051] In order to evaluate the affinity difference between the screened DO8 nucleic acid aptamer and the reported aptamers, the nucleic acid aptamer DO8 was compared with the reported aptamers DON1 and DON2 by using the nano-gold colorimetric method:
[0052] DON1: gcccggatcgagcagatatcaagcgcatgggc;
[0053] DON2: cgacttcctatagggcgacatatgatcgatgatatcccatgggcg.
[0054] First prepare nano-gold with an average particle size of about 13nm, add 1% trisodium citrate solution 1mL in 0.01% chloroauric acid solution 100mL, boil and keep for 15 minutes under stirring, stop heating and continue stirring and cooling to room temperature. Then optimize the volume of NaCl, mix 50 μL of ultrapure water and 50 μL of nano-gold with an average particle size of 13 nm, add 5-12 μL of 0.4M NaCl in different volumes, observe the color change of nano-gold under different NaCl volumes, the results show that , Adding 9 μL 0.4M NaCl...
Embodiment 3
[0057] Example 3 Application of DON aptamer in SERS detection
[0058] 1. Preparation of aptamer detection probe and its complementary chain
[0059] Design and synthesis of sulfhydryl-modified detection probes and their complementary strands, wherein the detection probe is the nucleic acid aptamer sequence DO8-1 (5'-SH-GGCACGGAGTCTGCCCGACTGGGGACCCTAGGATCACTTA-3') of vomitoxin, and the complementary strand sequence cDNA (5'-TAAGTGATCCTAGGG -SH-3').
[0060] 2. Preparation of gold magnetic nanoparticles and modification of aptamer DO8-1
[0061] (1) Preparation of gold magnetic nanoparticles
[0062] First, Fe with a particle size of about 150 nm was synthesized by a modified solvothermal reaction method. 3 o 4 Magnetic nanoparticles serve as cores. 0.324g anhydrous FeCl 3 Dissolve in 20mL ethylene glycol, then add 0.200g Na 3 Cit and 11.811g NaAc, stir well until completely dissolved. The above solution was transferred to a 50mL autoclave, placed in a blast oven at 200...
PUM
Property | Measurement | Unit |
---|---|---|
particle size | aaaaa | aaaaa |
particle diameter | aaaaa | aaaaa |
recovery rate | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com