Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Vomitoxin specific nucleic acid aptamer and application thereof

A technology of nucleic acid aptamer and deoxynivalenol, applied in instruments, biochemical equipment and methods, analytical materials, etc., can solve the problems of high precision, low detection limit, high detection cost, etc., and achieve the effect of rapid detection

Active Publication Date: 2021-12-10
BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, DON detection methods mainly include thin-layer chromatography, liquid chromatography, chromatography-mass spectrometry, enzyme-linked immunoassay, and colloidal gold immunochromatography. These methods have low detection limits and high precision, but the operation is complicated. , High detection cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vomitoxin specific nucleic acid aptamer and application thereof
  • Vomitoxin specific nucleic acid aptamer and application thereof
  • Vomitoxin specific nucleic acid aptamer and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Screening of DON-specific nucleic acid aptamers

[0030] 1. In vitro chemical synthesis of initial random single-stranded DNA (ssDNA) library and primers, the sequence is as follows: 5'-ATCCAGAGTGACGCAGCA-40N-TGGACACGGTGGCTTAGT' (40N represents 40 random nucleotides)

[0031] Upstream primer: 5'-ATCCAGAGTGACGCAGCA-3'

[0032] 5' phosphorylation downstream primer: 5'-P-ACTAAGCCACCGTGTCCA-3'

[0033] The random ssDNA library and primers were prepared into 100 μM storage solution with TE buffer and stored at -20°C for later use.

[0034] 2. Acquisition and processing of targets used in screening

[0035] Take 5 mg of DON and add 1 mL of 50% N,N-dimethylformamide (DMF) to dissolve, so that the final concentration is 5 mg / ml. Then take two portions of sapharose 6B (agarose 6B), 0.2 g each. Add 500 μL DON solution to one portion and 500 μL 50% DMF to the other. Add 10 μL of 10M NaOH to two parts of sapharose 6B respectively. Incubate overnight at 30°C. Then w...

Embodiment 2

[0050] Example 2 Affinity evaluation of DON nucleic acid aptamers

[0051] In order to evaluate the affinity difference between the screened DO8 nucleic acid aptamer and the reported aptamers, the nucleic acid aptamer DO8 was compared with the reported aptamers DON1 and DON2 by using the nano-gold colorimetric method:

[0052] DON1: gcccggatcgagcagatatcaagcgcatgggc;

[0053] DON2: cgacttcctatagggcgacatatgatcgatgatatcccatgggcg.

[0054] First prepare nano-gold with an average particle size of about 13nm, add 1% trisodium citrate solution 1mL in 0.01% chloroauric acid solution 100mL, boil and keep for 15 minutes under stirring, stop heating and continue stirring and cooling to room temperature. Then optimize the volume of NaCl, mix 50 μL of ultrapure water and 50 μL of nano-gold with an average particle size of 13 nm, add 5-12 μL of 0.4M NaCl in different volumes, observe the color change of nano-gold under different NaCl volumes, the results show that , Adding 9 μL 0.4M NaCl...

Embodiment 3

[0057] Example 3 Application of DON aptamer in SERS detection

[0058] 1. Preparation of aptamer detection probe and its complementary chain

[0059] Design and synthesis of sulfhydryl-modified detection probes and their complementary strands, wherein the detection probe is the nucleic acid aptamer sequence DO8-1 (5'-SH-GGCACGGAGTCTGCCCGACTGGGGACCCTAGGATCACTTA-3') of vomitoxin, and the complementary strand sequence cDNA (5'-TAAGTGATCCTAGGG -SH-3').

[0060] 2. Preparation of gold magnetic nanoparticles and modification of aptamer DO8-1

[0061] (1) Preparation of gold magnetic nanoparticles

[0062] First, Fe with a particle size of about 150 nm was synthesized by a modified solvothermal reaction method. 3 o 4 Magnetic nanoparticles serve as cores. 0.324g anhydrous FeCl 3 Dissolve in 20mL ethylene glycol, then add 0.200g Na 3 Cit and 11.811g NaAc, stir well until completely dissolved. The above solution was transferred to a 50mL autoclave, placed in a blast oven at 200...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle sizeaaaaaaaaaa
particle diameteraaaaaaaaaa
recovery rateaaaaaaaaaa
Login to View More

Abstract

The invention provides a vomitoxin specific nucleic acid aptamer and application thereof. According to the aptamer, deoxynivalenol (DON) is taken as a target, a competitive SELEX technology is utilized for seven rounds of repeated incubation, cleaning, dissociation, amplification and lambda-exonuclease digestion, and the nucleic acid aptamer capable of being specifically combined with DON is screened from a single-stranded DNA random library. After cloning, sequencing and synthesizing two representative sequences, affinity determination is performed on the representative sequences through SPR and PCR methods, the nucleic acid aptamer DO8 capable of being specifically bound with deoxynivalenol (DON) is obtained, and the sequence is shown as SEQ ID NO: 1. The nucleic acid aptamer provided by the invention has high specificity, can be combined with DON with high affinity, and can be used for rapid detection of polluted DON in agricultural products.

Description

technical field [0001] The invention belongs to the technical field of food safety detection, and in particular relates to a vomitoxin-specific nucleic acid aptamer and its application. Background technique [0002] Deoxynivalenol (DON), also known as vomitoxin, is one of the most common mycotoxins with a high pollution rate and widely exists in wheat, barley, corn, oats and other food crops. DON has a wide range of toxic effects, and has toxic effects on cell cycle and apoptosis, body biochemical reactions, digestion and immune system, and has certain embryotoxicity and teratogenicity. Countries and organizations around the world have set limits on the content of DON in food. my country's national standard GB 2761-2017 stipulates that the limit of DON in corn, cornmeal (slag, flakes), barley, wheat, oatmeal, and wheat flour is 1000 μg / kg. [0003] At present, DON detection methods mainly include thin-layer chromatography, liquid chromatography, chromatography-mass spectrom...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/115G01N33/53G01N33/58
CPCC12N15/115G01N33/5308G01N33/582C12N2310/16G01N2333/37Y02A50/30
Inventor 王蒙翟文磊武琳霞韦迪哲付海龙
Owner BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com