Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Drug delivery carrier composition for treating hepatic fibrosis and preparation method thereof

A technology for liver fibrosis and delivery carrier, applied in the field of biomedicine, can solve the problem of limited anti-fibrosis treatment effect, and achieve the effect of long residence time and good versatility

Active Publication Date: 2022-01-28
CHINA PHARM UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] At present, the research on the underlying mechanism of the development of liver fibrosis is quite mature, and the development of fibrosis involves multiple signaling pathways, resulting in the limited effect of single-drug, single-target anti-fibrosis therapy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Drug delivery carrier composition for treating hepatic fibrosis and preparation method thereof
  • Drug delivery carrier composition for treating hepatic fibrosis and preparation method thereof
  • Drug delivery carrier composition for treating hepatic fibrosis and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041]

[0042] Synthesis of composite nanomaterials (SCLMs) derived from the self-assembly of silica and amphiphilic polymers

[0043] Pick (hereinafter abbreviated as F108, F108 is a triblock copolymer of ethylene oxide-propylene oxide-ethylene oxide PEO-PPO-PEO, PEO is hydrophilic, PPO is hydrophobic, Mw, 14.6KDa, 0.25g) at room temperature It was dissolved in HCl (7.5mL, 2.0M) solution, and stirred for 15min to fully dissolve it. Add 240 μL of cyclohexane, sonicate for 2 min, make it mix well until the solution turns milky white, continue to stir at room temperature for 0.5 h to make it fully dissolved. Add 268 μL of tetraethyl silicate, stir at room temperature for 4 h, and add 40 μL of dimethyldiethoxysilane DEDMs. After 24 h of reaction, the solution was collected and dialyzed overnight in deionized water using a dialysis membrane with a molecular weight of 20,000 D to remove impurities.

[0044] The obtained composite nanomaterial was placed in a rotary evaporato...

Embodiment 2

[0056]

[0057] Synthesize FEN1-hpDNA-SCLMs according to the method in Example 1, label the 5-end of the target substrate S2 with fluorescent Cy2, and the substrate matches the hpDNA probe hp-2-SH with a stem-loop structure.

[0058] The full sequence of the gel-running probe is as follows (connected to the 5'-3' of the thiol group, where the underlined part of the sequence remains unchanged)

[0059] hp-2-SH:

[0060] AAAAAAAAAAACCGAAGGGCATGAGCTGCT AGAGTCGGCCTTTTGGCCGACTCTC ;

[0061] Gel running substrate (5'-3')

[0062] S2:

[0063] Cy2-CGUGCAGCUCAUCAUGCAGCAGCUCAUGCCCUUCGG

[0064] From hpDNA, single-stranded RNA (ssRNA) substrate (10pmol), 3-(N-morpholine) propanesulfonic acid MOPS (10mM), 0.05% Tween 20Tween-20, 0.01% ethylphenyl polyethylene glycol nonidet P-40, MgCl 2 (7.5mM) and an appropriate amount of FEN1 to prepare a 10 μL reaction mixture, and react at 37°C for 2 hours. The 5' end of the substrate ssRNA is labeled with fluorescent FAM. The products obt...

Embodiment 3

[0066] 4 )-induced liver fibrosis in mice>

[0067] Synthesis of Cy5.5-modified FEN1-hpDNA-SCLMs and FEN1-hpDNA-CTSCLMs:

[0068] Cy5.5 is a near-infrared fluorescent dye, and its maximum excitation light and emission light are 675nm and 694nm, respectively. Weigh Cy5.5 (2 mg) and dissolve it in 1 mL of anhydrous dimethylformamide (DMF), and store at -20°C in the dark. Add 2 μL of aminopropyltriethoxysilane (APES) to 18 μL of DMF, mix well, take 2 μL of the above mixed solution and add it to 50 μL of Cy5.5 (2 mg·mL-1) solution, and react for 24 h at room temperature in the dark. Under dark conditions, 100 μL of triethanolamine solution (triethanolamine: deionized water mass ratio 1:1) was added to 5 mL of FEN1-hpDNA-SCLMs (20 mg·mL-1) solution, followed by pretreated Cy5.5 The solution was stirred at room temperature for 24 h in the dark. After the reaction, the solution was taken out and transferred to a dialysis bag with a molecular weight of 20,000 D, and placed in deion...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a drug delivery carrier composition for treating hepatic fibrosis and a preparation method thereof. The drug carrier composition comprises a composite nano-material obtained through self-assembly, a targeting peptide which is connected with the composite nano-material through a click reaction and is used for targeting hepatic stellate cells, a composition for carrying out targeted cleavage on target nucleic acid, and a chemical drug which is loaded in the composite nano-material and is used for treating hepatic fibrosis. By utilizing the ligand-receptor binding mediated targeting effect, the targeting peptide for targeting the hepatic stellate cells enables the composite nano material to specifically target receptors on the surfaces of the activated hepatic stellate cells in the liver, so that the drug carrier is accurately delivered into the hepatic stellate cells; after the carrier enters cells, the target sequence is cleaved by the composition for performing targeted cleavage on the target nucleic acid on the surface of the carrier, the chemical drug loaded in the hydrophobic core is slowly released for a long time, and the chemical drug and the gene therapy are combined for action, so that the treatment effect of hepatic fibrosis is effectively improved.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to a drug delivery carrier composition for treating liver fibrosis and a preparation method thereof. Background technique [0002] Liver fibrosis is chronic liver damage caused by toxins, pathogens, metabolic diseases, or autoimmune diseases, which predisposes to repetitive tissue accumulation and may further develop into cirrhosis, liver failure, and even liver cancer. Chronic liver injury from any cause leads to hepatic fibrosis, which interferes with normal tissue function. [0003] Activation of hepatic stellate cells (HSCs) is a key factor in liver fibrosis. In normal liver, HSCs are in a quiescent state. Following fibrogenic stimulation, HSCs are activated and then transformed into myofibroblast-like cells expressing smooth muscle actin (α-sma), leading to contraction of liver tissue and production of large amounts of extracellular matrix (ECM) and matrix met...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K47/54A61K47/62A61K47/64A61K48/00A61K38/46A61K45/06A61K47/34A61P1/16A61K31/357A61K31/704A61K31/7048
CPCA61K47/64A61K47/62A61K47/549A61K47/54A61K47/34A61K45/06A61K38/465A61K48/005A61K48/0008A61P1/16A61K31/357A61K31/704A61K31/7048Y02A50/30
Inventor 赵灵之徐澍顾家玉彭娟娟田坤
Owner CHINA PHARM UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com