Recombinant escherichia coli with high succinic acid yield and construction method and application thereof

A technology for recombining Escherichia coli and Escherichia coli, which is applied in the field of bioengineering, can solve the problems of cofactor metabolic imbalance, metabolic imbalance, product yield and low production intensity, etc., to improve the ability of acid resistance and hyperosmotic resistance, multi-reduction force effect

Active Publication Date: 2022-02-08
JIANGNAN UNIV +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although a lot of progress has been made in the research of fermenting succinic acid with Escherichia coli, the production efficiency of Escherichia coli fermentation is low at present, there are usually by-products such as lactic acid, formic acid, acetic acid, ethanol in the fermentation broth, and the cofactor metabolism in the fermentation process is unbalanced , can not tolerate high concentration of product concentration and substrate glucose concentration, high concentration osmotic pressure and fast absorption and utilization of glucose lead to metabolic imbalance, low product yield and production intensity, easy loss of strain plasmids and other problems

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant escherichia coli with high succinic acid yield and construction method and application thereof
  • Recombinant escherichia coli with high succinic acid yield and construction method and application thereof
  • Recombinant escherichia coli with high succinic acid yield and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1E

[0055] Construction of Example 1E.coli FMME-N-5 (ΔfocA-pflB-ΔldhA-Δpta-ackA) CRISPR-Cas9 system

[0056] The Escherichia coli CRISPR-Cas9 system consists of two basic plasmids, pCas-lac and pTargetF. Plasmid pCas-lac is an episomal plasmid of Escherichia coli, which contains L-arabinose-induced expression of Red recombinase element, Cas9 protein coding gene Cas9, thermosensitive Type elements and the sgRNA used to induce and eliminate the plasmid pTargetF, the kanamycin resistance gene KanR, etc. All plasmid series containing pCas-lac derivatives need to be cultured at 30°C to ensure normal replication of the plasmid without loss. Plasmid pTargetF is an E. coli episomal plasmid containing the spectinomycin resistance gene aadA and the promoter pJ23119 for transcription of sgRNA.

[0057] According to the sequence of the target editing site, primers were designed to amplify a 20-base sequence (N20) that matched the target site, and then the sequence was cloned into the pTarget...

Embodiment 2

[0079] Example 2: Construction of E.coli FMME-N-5 (ΔfocA-pflB-ΔldhA-Δpta-ackA)-ΔfdhF-fdh1 strain

[0080] (1) Design primers according to the upstream and downstream sequences of E. coli fdhF gene. According to the Escherichia coli genome sequence published on NCBI, find the formate dehydrogenase fdhF sequence, select the cleavage site N20 (agatccgctacaaactgacg) on ​​the fdhF gene, design the reverse amplification primers for pTargetF full plasmid PCR, and obtain the pTargetF-fdhF knockout plasmid ,Such as figure 1 As shown, wherein, the primers are as follows:

[0081] sgRNA-U1:agatccgctacaaactgacggttttagagctagaaatagcaagtt

[0082] sgRNA-D1: cgtcagtttgtagcggatctactagtattatacctaggactgagc.

[0083] (2) PCR method was used to amplify the upstream homology arm, downstream homology arm and fdh1 homology arm replaced by fdh1, and the primers were as follows:

[0084] Amplified FDH1 replaces the upstream homology arm primer

[0085] F-U1: cgttacaaccagtcagtactgaacg

[0086] F-D...

Embodiment 3

[0094] Example 3: RBS optimized expression of the outer membrane protein regulator OmpR

[0095] (1) Primers were designed according to the upstream and downstream sequences of the Escherichia coli outer membrane protein regulator OmpR gene. According to the Escherichia coli genome sequence published on NCBI, the sequence of the outer membrane protein regulator OmpR was found, and the cleavage site N20 (actgctggcccgtatccgtg) was selected on the gene, and the reverse amplification primers for pTargetF full plasmid PCR were designed to obtain pTargetF-OmpR knockout plasmids, such as figure 2 As shown, wherein, the primers are as follows:

[0096] sgRNA-U2: actgctggcccgtatccgtggttttagagctagaaatagcaagtt

[0097] SGRNA-D2: cacggatacgggccagcagtactagtattatacctaggactgagc.

[0098] (2) Synthesize the gene sequence J23101-RBS8-OmpR in which OmpR, RBS8 and the artificial promoter J23101 are continuous by the method of gene synthesis, and the gene sequence is shown in SEQ ID NO.4.

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of bioengineering, in particular to recombinant escherichia coli with high succinic acid yield and a construction method and application thereof. According to the recombinant escherichia coli with high succinic acid yield, a gene fdhF for encoding formate dehydrogenase in escherichia coli is replaced by a formate dehydrogenase gene fdh1 from candida, and an outer membrane protein regulator OmpR for resisting acid stress and osmotic pressure stress is up-regulated. The formate dehydrogenase gene fdhF coded in host bacteria FMME-N-5 is replaced by a formate dehydrogenase gene fdh1 of candida by adopting a CRISPR-cas9 gene editing technology, and a key outer membrane protein regulator OmpR resistant to acid stress and osmotic pressure stress is up-regulated by applying an RBS sequence and a promoter strategy; the obtained recombinant escherichia coli has no resistance, and has osmotic pressure resistance and can efficiently produce succinic acid.

Description

technical field [0001] The invention relates to the technical field of bioengineering, in particular to a recombinant Escherichia coli with high succinic acid production and its construction method and application. Background technique [0002] Succinic acid, also known as succinic acid, is an important C4 platform compound. As a starting material for the synthesis of general chemicals, succinic acid is widely used in the fields of food, chemistry, and medicine. The traditional production method of succinic acid is chemical synthesis, mainly including paraffin oxidation, cyanidation hydrolysis of methyl chloroacetate and catalytic hydrogenation of vanadium pentoxide. However, due to the reduction of petroleum resources and the increasingly serious environmental pollution, The disadvantages of chemical synthesis methods are becoming more and more obvious. The production of succinic acid by fermentation can get rid of the dependence on the non-renewable strategic resource-pe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/70C12N15/90C12N15/53C12N15/31C12N15/55C12P7/46C12R1/19
CPCC12N9/0008C07K14/245C12N15/70C12N15/902C12N9/22C12P7/46C12Y102/01002
Inventor刘立明罗旭王学明陈修来刘佳唐文秀徐祖伟高聪郭亮胡贵鹏宋伟
OwnerJIANGNAN UNIV