Fungal micro-organism having an increased ability to carry out biotechnological process(es)
A biotechnology, microbial technology, applied to the regeneration of redox cofactors. field
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Example 1 - screening of applicable oxidoreductases
[0058] We used a screening system for NADP(H)-related oxidoreductases based on deletion of phosphoglucose isomerase in Saccharomyces cerevisiae. The strain with the deletion (Apgi1) was unable to grow in glucose, which was associated with a lethal overgrowth of NADPH (Boles et al., 1993). In K. lactis the deletion did not result in a similar phenotype (Gonzales Siso et al., 1996). We used Saccharomyces cerevisiae deficient in phosphoglucose isomerase and screened K. lactis that grew on glucose for the K. lactis gene that enables the Δpgi1 mutant to grow on glucose. We found the gene for NADP-linked GAPDH, as described above. Thus, this screening method provides genes suitable for use in the practice of the present invention.
[0059] Construction of host strains for library screening; PGI1 gene deletion in Saccharomyces cerevisiae
[0060] Deletion of the PGI1 gene of S. cerevisiae haploid strain CEN.PK2. The ...
Embodiment 2
[0071] Example 2 - Cloning and expression of GAPDH homologues, determination of NAPDH-GAPDH activity
[0072] Cloning of the K. lactis GAPDH homologue into the yeast expression vector pYES2:
[0073] A GAPDH homologue was amplified by PCR from plasmid B1513 in Example 1 using the following primers: GAPBAMH: AA GGATCC AAGCGTCTCCTTAAACACCAGC and GAPHIND:ATA AAGCTT AAGATGCCCGATATGACAAACGAATCTTC. The annealing temperature for PCR was 65°C. The PCR product was digested with BamHI and HindIII and ligated into the corresponding site of the multiple cloning site of pYES2 vector (Invitrogen). pYES2 is a yeast expression vector with multiple cloning sites between a galactose-inducible promoter and a terminator. The obtained vector was named B1612.
[0074] Expression of the Kluyveromyces lactis GAPDH homologue in Saccharomyces cerevisiae
[0075] The above plasmid B1612 and the control plasmid pYES2 were transformed into S. cerevisiae strain CEN.PK2. The obtained strain was...
Embodiment 3
[0076] Example 3 - Effect of Kluyveromyces lactis GAPDH homologues on D-xylose fermentation in Saccharomyces cerevisiae strains
[0077] For the fermentation of D-xylose, the NAPD-GAPDH gene was linked to a yeast expression vector with the ADH1 promoter. Therefore, NAPD-GAPDH was amplified by PCR as described in Example 2, except that the following primers were used, each of which contained a BamHI restriction site: (BamHI site is underlined) AA GGATCC AAGATGCCCGATATGACAAACGAATCTTC and AA GGATCC AAGCGTCTCCTTAAACACCAGC. The PCR product was then cloned into TOPO vector (Invitrogen) and a 1 kb BamHI fragment from the resulting vector was ligated into the BamHI site of pVT102U (Vernet et al., 1987). The resulting vector (B1731) was then used to transform a Saccharomyces cerevisiae strain (H2217, Aristidou et al. 1999) that overexpresses the enzymes of the xylose pathway, namely xylose reductase (XR), xylitol dehydrogenase (XDH) and xylose Glucokinase (XK) is integrated into t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More