Gene for controlling rice ear sprouting period and its uses

A technology of heading date and gene, which is applied in the field of controlling the gene of rice heading date, can solve the problems of time-consuming and labor-intensive, and achieve the effect of high efficiency and fast speed

Inactive Publication Date: 2009-01-14
HUAZHONG AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] The above-mentioned heading date genes or QTLs are all cloned by traditional map-based cloning. First, a good population must be constructed, such as recombinant inbred lines, DH populations or near-isogenic lines, etc., and then a large number of markers are added. Co-separation of markers, gradually narrowing down the target segment, is a time-consuming and labor-intensive process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene for controlling rice ear sprouting period and its uses
  • Gene for controlling rice ear sprouting period and its uses
  • Gene for controlling rice ear sprouting period and its uses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Isolation and cloning of OsCM2 gene

[0037] 1. Create a mutant library (T0 generation)

[0038] The vector pSMR-J18R was donated by Australia CAMBIA Laboratory (Center for the Application of Molecular Biology to International Agriculture), such as figure 1 , Randomly insert T-DNA (including Enhancer Trap) (Springer P S. Gene Traps: Tools) into the genome of japonica rice variety Zhonghua 11 (Oryza sativa L.subsp.japonica cv.Zhonghua 11) mediated by Agrobacterium EHA105 for plantdevelopment and genomics. Plant Cell, 2000, 12: 1007-1020) to create a mutant library. The mutant library was constructed according to the method described by Wu et al. (Wu et al., Development of enhancer traplines for functional analysis of the rice genome. Plant J, 2003, 35:418-427). At present, about 100,000 independent transformants have been obtained.

[0039] 2. Field Screening of T1 Generation Tiller Characters

[0040] 3000 T1 generation seeds were selected from the T0 generation...

Embodiment 2

[0055] Example 2: Gene expression analysis

[0056] The mutant obtained by the present invention is caused by T-DNA randomly inserted into the rice genome. The T-DNA contains Enhancer Trap, and the reporter gene on it has a small sheared promoter, which contains only TATAbox and transcription initiation point. , Is not enough to initiate reporter gene expression, but can only be expressed with the help of adjacent enhancer elements. By detecting the expression pattern of the reporter gene, the expression pattern of the gene controlled by the enhancer element can be judged. GUS staining results for mutants, such as Figure 8 , All expressed in roots, stems and leaves, which is the same as the expression pattern of this gene in Arabidopsis (Jenny Eberhard et al., Cytosolic and plastidic chorismate mutase isozymes from Arabidopsis thaliana: molecular characterization and enzymatic properties. Plant Journal, 1996 , 10(5):815-821). This also proves from another angle that T-DNA is inse...

Embodiment 3

[0057] Example 3: RNAi (RNA interference) transformation to verify gene function

[0058] Design RNAi fragments in the first exon and the last exon of OsCM2 gene. Primer sequence: 1588Si1 5'ggg gac cac ttt gta caa gaa agc tgg gt AAACGGAGATGAAGAAAGATCC 3', 1588Ai1 5'ggg gac aag ttt gta caa aaa agc agg ct GTCACTTTGGAGGACAATGCTG 3', gtag tac 2 gt gatt agc tgg gt CTTACCTTGGCGTGCAGAAC 3', 1588Ai2 5'ggg gac aag ttt gta caa aaa agc agg ct GAGCTGTGGAGGATCAGCAG 3'. The total volume of the PCR reaction system is 20μl, rice genomic DNA template 1ul (about 50ng), 1×Taq enzyme reaction buffer, 25mM MgCL 2 1.2ul, 2mM dNTP 1.5ul, 10uM primer 0.2ul, 50% glycerol 2ul, 0.3 unit rTaq enzyme (Takara company), add ddH 2 O to 20μl. The reaction procedure is: denaturation at 94°C for 3 minutes, 50s at 94°C, 80s at 55°C, and 35 cycles at 72°C for 90s, and extension at 72°C for 5 minutes. The two fragments are amplified in 10 tubes. The PCR products are collected and purified in 2 1.5ml centrifuge tubes. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a control gene OsCM2 separating and cloning method and application of rice ear sprouting period, which is characterized by the following: possessing 50% consanguinity for protein coded by OsCM2 gene and CM-2 gene; controlling the ear sprouting period through improving or weakening OsCM2 gene; improving the adaptability of region and season.

Description

Technical field [0001] The invention belongs to the field of plant genetic engineering. Specifically, it relates to a gene that controls the heading date of rice, and uses forward genetics to screen a library of rice T-DNA insertion mutants. The clones are isolated and cloned by co-segregation and detection of mutation phenotypes and T-DNA insertion site genes and complementary experiments. The OsCM2 gene is a gene that controls the heading date of rice. The invention also relates to a vector containing the gene or its homologous gene and to the application of the gene or its functional analogue to regulate the heading period of plants in agricultural production. Background technique [0002] Rice is an important food crop, and more than one-third of the world's people rely on it as their staple food. At the same time, rice has been used as a model plant for genome research due to its small genome, fine genetic and physical maps, relatively easy transgenic technology, and colline...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/82C07K14/415
Inventor张启发陈志辉吴昌银
OwnerHUAZHONG AGRI UNIV