Patents
Literature
45 results about "Field screening" patented technology
Efficacy Topic
Property
Owner
Technical Advancement
Application Domain
Technology Topic
Technology Field Word
Patent Country/Region
Patent Type
Patent Status
Application Year
Inventor
Monoclonal antibody pair for detecting cat immunodeficiency virus p24 protein and application thereof
ActiveCN120965872AImmunoglobulins against virusesFermentationDiseaseComplementarity determining region
The invention belongs to the technical field of biological detection, and particularly relates to a monoclonal antibody pair for detecting cat immunodeficiency virus p24 protein and application of the monoclonal antibody pair. The monoclonal antibody pair is a monoclonal antibody 1D8 and a monoclonal antibody 1H10 and can specifically recognize cat immunodeficiency virus p24 protein, and sequences of complementary determining regions of variable regions of a heavy chain and a light chain of the 1D8 and the 1H10 are clear and are respectively shown as SEQ ID NO.1-12. The antibody pair can effectively avoid cross reaction, and the accuracy and sensitivity of detection are remarkably improved; the colloidal gold test strip constructed on the basis of the antibody pair is simple, convenient and rapid to operate, is suitable for early antigen detection of FIV infection, solves the problem that natural infection and vaccine immunity cannot be distinguished in existing antibody detection, and provides a reliable technical means for FIV field screening and disease prevention and control.
Owner:BEIJING SUBENYUANHE BIOTECHNOLOGY CO LTD
Portable field screening device for environmental remediation microbial strains
PendingCN120924382ABioreactor/fermenter combinationsBiological substance pretreatmentsMicroorganismUltrafiltration
The invention discloses a portable field screening device for environmental remediation microbial strains, and relates to the field of environmental remediation. The invention relates to a portable field screening device for environmental remediation microbial strains, which comprises a tank body which is a high-strength and light-weight aluminum alloy tank, and further comprises a filter cartridge arranged in the tank body, a filter element arranged in the tank body, and a filter element arranged in the tank body, the driving motor is fixedly connected to the upper end of the tank body; the driving shaft is fixedly connected to the output end of the driving motor; solid-liquid separation of the soil turbid liquid is efficiently completed through a centrifugal and ultrafiltration graded filtration mode, compared with a traditional method, the device has the advantages of being high in portability, high in separation efficiency and good in effect, impurities can be accurately intercepted, microbial losses are reduced, microbial strains with specific functions are rapidly screened for an environment restoration site, a high-quality bacterium-containing liquid sample is provided, and the method is suitable for popularization and application. The efficiency and accuracy of screening of microbial strains in environment restoration work are improved, and efficient development of the environment restoration work is promoted.
Owner:INNER MONGOLIA ACADEMY OF SCIENCE & TECHNOLOGY
Nondestructive detection method and system for pesticide residues of field drinking chrysanthemum
PendingCN120727132AMolecular entity identificationScattering properties measurementsClothianidinPesticide residue
The invention discloses a nondestructive testing method and system for pesticide residues of field drinking chrysanthemum, and the method comprises the steps: obtaining hyperspectral reflectivity data of leaves of the drinking chrysanthemum in a key growth period after pesticide drip irrigation, and carrying out data preprocessing; a quantitative estimation model of the leaf hyperspectral reflectivity and the leaf clothianidin actually measured content is constructed through statistical modeling; determining a regression model equation of the clothianidin content in the leaves and inflorescence by using actually measured data, and calculating the inflorescence residue level according to a leaf detection result; a drinking chrysanthemum clothianidin residue early warning threshold value is set, the hyperspectral reflectivity of drinking chrysanthemum leaves is collected through hyperspectral equipment and input into the model, and drinking chrysanthemum clothianidin residue early warning is achieved; according to the method, early warning of pesticide residues is achieved before chrysanthemum harvesting, especially field rapid screening and quantitative analysis of novel pesticides such as clothianidin are achieved, the technical blank of an existing hyperspectral technology in pesticide residue detection and application of medicinal plants is filled up, and the chrysanthemum quality safety guarantee level is improved.
Owner:NANJING AGRICULTURAL UNIVERSITY
Urine prohibited substance detection method based on double-line spectrum and contrastive analysis clustering
PendingCN121656560AColor/spectral properties measurementsBiological testingFood safetySpectral analysis
The invention relates to the technical field of food safety detection and spectral analysis, in particular to a urine prohibited substance detection method based on double-line spectrum and contrastive analysis clustering, which comprises the following steps: respectively acquiring reflection spectrum signals of a T region and a C region of a detection card under different wavebands by using two spectrum sensors; respectively carrying out temperature compensation, denoising processing, smoothing processing and normalization processing on the reflection spectrum signals of the two regions; calculating a spectrum difference and a peak value ratio according to the reflection spectrum signals of the T region and the C region under different wavebands; judging whether the spectrum difference is smaller than a set threshold and the peak value ratio is smaller than the set threshold, and if not, outputting that the detected substance does not exceed the standard; otherwise, the detected substance exceeds the standard, and the concentration corresponding to the current spectrum difference is searched according to the concentration-spectrum difference mapping table. According to the invention, a detection result is automatically judged by a threshold difference analysis method, so that high-throughput, low-cost, rapid and objective field screening capability is realized.
Owner:CHONGQING UNIV OF POSTS & TELECOMM
SaaS-based multi-party system data pushing method and system, and storage medium
The invention provides a SaaS-based multi-party system data pushing method and system and a storage medium, and the method comprises the steps: obtaining a differentiated pushing rule pre-configured by a target tenant, the differentiated pushing rule comprising a field selection rule for a target interface, a data filtering rule and a data format conversion rule; obtaining original data to be sent to a target tenant, and performing field screening on the original data based on a field selection rule to obtain first intermediate data; performing content filtering on the first intermediate data based on a data filtering rule to obtain second intermediate data; performing format conversion on the second intermediate data based on a data format conversion rule to obtain to-be-transmitted data meeting the customized format requirement of the target tenant; and sending the to-be-transmitted data to a receiving system corresponding to the target tenant. According to the invention, multi-party system data pushing can be carried out safely and efficiently at low cost.
Owner:SHANGHAI ZHIYIN INFORMATION TECH CO LTD
Method for detecting tetrahydrocannabinol and hydride thereof by utilizing specificity of bridged beta-cyclodextrin and application of tetrahydrocannabinol and hydride thereof
PendingCN121409940AMaterial analysis by observing effect on chemical indicatorFluorescence/phosphorescenceHexamethylenediamineCyclodextrin
The invention relates to a method for specifically detecting tetrahydrocannabinol and hydride thereof by utilizing bridged beta-cyclodextrin, and belongs to the technical field of analysis and detection of supramolecular materials. The method comprises the following steps: firstly, combining 1, 6-hexamethylenediamine bridged bis-beta-cyclodextrin with an indicator to form a supramolecular probe; in a buffer system with a pH value of 9-11, tetrahydrocannabinol or a hydride thereof specifically competes to be combined with a cavity and displaces an indicator by utilizing a synergistic inclusion effect of a bridging subject and dissociation difference of guest molecules, so that the system is subjected to fluorescence quenching or color change, and a structural analogue cannabidiol does not generate obvious interference. The method solves the problems that the sensitivity is low and cannabidiol cannot be effectively distinguished in the prior art through cooperation of specific main body construction and environment regulation, has the advantages of being rapid in detection, high in specificity, high in accuracy and the like, and is suitable for environment monitoring and field screening.
Owner:IND CROPS RES INST YUNNAN ACAD OF AGRI SCI
Saline-alkaline tolerant rice mutation breeding identification and evaluation system based on heavy ion beam radiation
The invention discloses a saline-alkaline tolerant rice mutation breeding identification and evaluation system based on heavy ion beam radiation, and relates to the technical field of intelligent agriculture, and the system comprises a phenotype dynamic sensing module which is used for carrying out real-time monitoring and abnormity identification on the growth state of rice under saline-alkaline stress so as to identify and output an early abnormal phenotype signal, and determining the abnormal phenotype of plant growth. According to the method, multi-dimensional phenotype data of rice under different saline-alkaline gradients are collected in real time through a multi-source sensor network, the problem of inconsistent growth periods caused by environmental differences is solved by utilizing a dynamic time warping algorithm, a basic identification data set with aligned time sequences is constructed, abnormal phenotype identification is further performed by adopting a local abnormal factor algorithm, and the identification accuracy is improved. Early deterioration early warning of the plant growth state under saline-alkali stress is achieved, the problems of high misjudgment rate and low efficiency in traditional field screening are effectively solved, and reliable data support is provided for early identification of saline-alkali tolerant rice varieties.
Owner:NORTHEAST INST OF GEOGRAPHY & AGRIECOLOGY C A S
Dpo rt-pcr primer set, detection method, kit for detecting five citrus viruses and application thereof
ActiveCN114790496BMicrobiological testing/measurementMicroorganism based processesDiseaseCitrus plant
The application discloses a DPO RT-PCR primer group for synchronously detecting five citrus viruses, a detection method, a kit and application of the DPO RT-PCR primer group, and sequences of the primer group are shown as SEQ ID NO. 1-SEQ ID NO. 10. The application designs specific DPO RT-PCR primers for citrus tristeza virus, citrus tatter leaf virus, citrus yellow vein clearing virus and citrus leaf mottle virus, and the detection primers can effectively remove primer dimer interference, and the five viruses can be detected from samples at the same time. The detection method is simple and efficient, and only needs to use a common PCR instrument and an electrophoresis instrument to detect, and has the characteristics of rapidness, economy, high accuracy and high sensitivity, and can be used for large-scale screening of field citrus plants and epidemic prevention detection before seedling transportation, and provides technical support for healthy seedling detection and field screening of diseases.
Owner:GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
High-sensitivity wide-spectrum specific antibody against parathion, parathion-methyl and fenitrothion and recombinant expression plasmid thereof
The invention discloses a high-sensitivity wide-spectrum specific antibody for resisting parathion, parathion-methyl and fenitrothion, the high-sensitivity wide-spectrum specific antibody comprises a heavy chain constant region, a heavy chain variable region, a light chain constant region and a light chain variable region, and the amino acid sequence of the heavy chain variable region is as shown in SEQ ID NO: 2; the amino acid sequence of the light chain variable region coding gene is shown as SEQ ID NO: 4. The invention also provides an antibody expression plasmid. The obtained variable region sequence gene is respectively connected to an expression vector containing a heavy chain constant region gene and a light chain constant region gene, and a new recombinant full-length antibody is successfully obtained through an HEK293 (F) mammalian cell expression system. Based on the characteristics of stability and easy preservation of recombinant expression plasmids, the recombinant expression plasmids can be used for multi-batch repeated production of prohibited and limited organophosphorus pesticide recombinant antibodies for resisting parathion and the like; a stable and reliable core reaction reagent is provided for construction of an immunoassay method for multiple residues of organophosphorus pesticides such as parathion in a development environment and a food sample and development of a field screening product.
Owner:ZHEJIANG UNIV
Detection method and kit for identifying DNA (Deoxyribose Nucleic Acid) of Changlin bark beetles
PendingCN120989222AMicrobiological testing/measurementDNA/RNA fragmentationLonghorn beetleQuarantine
The invention relates to the technical field of molecular biological detection, in particular to a method for detecting DNA (Deoxyribose Nucleic Acid) of Changlin bark beetles in a sample, which can realize visual rapid detection of Changlin bark beetles based on an RPA-CRISPR / Cas12a system. The invention provides a primer combination and a specific crRNA sequence for detecting DNA (Deoxyribose Nucleic Acid) of Changlin bark beetles. The detection method disclosed by the invention is simple and convenient to operate, short in reaction time, high in sensitivity and specificity, and suitable for port quarantine, forestry monitoring and field screening, the detection result can be directly interpreted, the detection can be carried out without a heating instrument, and the limitation that traditional detection depends on laboratories and professional operation is broken through; an efficient and convenient detection means is provided, and powerful technical support is provided for early warning and precise prevention and control of the beetles.
Owner:BEIJING FORESTRY UNIVERSITY
Enterprise carbon information disclosure standard adaptation method and system
The invention provides an enterprise carbon information disclosure standard adaptation method and system, and the method comprises the steps: carrying out the structural analysis and semantic extraction of a carbon information disclosure standard list, obtaining a clause standard semantic set, constructing a clause knowledge graph corresponding to the clause standard semantic set, carrying out the entity analysis and feature extraction of enterprise carbon monitoring data, and obtaining a clause knowledge graph corresponding to the clause standard semantic set; a carbon monitoring feature set is obtained, the carbon monitoring feature set is mapped to a clause knowledge graph based on a double-tower alignment algorithm, an enterprise carbon information graph is obtained, missing field prediction and context complementation are carried out on the enterprise carbon information graph, and a complemented carbon information graph is obtained; performing time sequence prediction on the complemented carbon information atlas based on a conditional diffusion model, and performing soft and hard constraint optimization on the complemented carbon information atlas after time sequence conditional diffusion based on a real-time disclosure standard to obtain an optimized carbon information atlas; and performing standard field screening and carbon information disclosure on the optimized carbon information atlas according to a real-time disclosure standard to obtain enterprise disclosure carbon information.
Owner:STATE GRID ZHEJIANG ELECTRIC POWER CO LTD
Primer and probe composition for detecting chrysanthemum B virus, kit and detection method and application thereof
PendingCN120591464AMicrobiological testing/measurementMicroorganism based processesDiagnosis laboratoryMosaic virus
The invention discloses a primer and probe composition and a kit for detecting a chrysanthemum B virus, and a detection method and application of the primer and probe composition, the kit, the detection method and the application of the primer and probe composition, the rapid detection of the chrysanthemum B virus is completed within 5 minutes through the combination of recombinase polymerase amplification (RPA) and lateral flow test strip (LFD) technologies and the combination of isothermal amplification and visual detection advantages, and the sensitivity is 1000 times of that of a conventional RT-PCR method. And the method does not depend on complex instruments and equipment and is suitable for field and basic laboratory operation. The primer and the probe are designed for a conserved domain of a chrysanthemum B virus genome, do not have cross reaction with common chrysanthemum viruses such as chrysanthemum dwarf viroid CSVd, chrysanthemum chlorotic mottle viroid CChMVd, tobacco mosaic virus TMV and the like and host plants, and are high in specificity. A detection result is directly interpreted through color development of the test strip, and the stability is high. The method is highly effective in chrysanthemum seedling detoxification identification, early warning of diseases and large-scale field screening, and provides technical support for accurate prevention and control of chrysanthemum virus diseases and healthy seed industry development.
Owner:NANJING AGRICULTURAL UNIVERSITY
Haploid molecular marker related to cotton fiber strength and application of detection primer of haplotype molecular marker
ActiveCN121951126AReduce screening costsImprove stabilityMicrobiological testing/measurementPlant genotype modificationBiotechnologyChromosome regions
The invention discloses a haplotype molecular marker related to cotton fiber strength and application of a detection primer of the haplotype molecular marker, and relates to the technical field of plant molecular biology and genetic breeding. The haplotype molecular marker is located in 112, 985, 431-112, 990 and 059bp regions of A06 chromosome of a cotton reference genome, a haplotype block is formed by nine closely linked SNP (Single Nucleotide Polymorphism) sites, the incidence relation between three haplotypes Hap1, Hap2 and Hap3 in the block and fiber strength is defined, and a new molecular target is provided for cotton fiber quality breeding. Compared with a single SNP marker, the haplotype molecular marker provided by the invention has higher stability and phenotype prediction accuracy under a complex genetic background. Genetic typing can be carried out in the cotton seedling stage based on the marker, fiber maturation does not need to be waited, the breeding period is greatly shortened, and the field screening cost is reduced.
Owner:COTTON RES INST HEBEI ACAD OF AGRI & FOREST SCI
Human resource data security sharing method and system
The invention discloses a human resource data security sharing method and system, and particularly relates to the field of human resource data security, and the method comprises the steps: collecting a behavior signal sequence of a user on an identity authentication platform of human resources, the behavior signal sequence comprising a page access path, an interactive operation type, time rhythm distribution and an equipment switching event; segmenting the behavior signal sequence into continuous time sequence operation fragment groups according to a unified time sliding window mechanism; and performing feature coding processing on each time sequence operation fragment group, extracting operation frequency, rhythm change, equipment fingerprint and interface jump features, and constructing a corresponding behavior embedding vector block. By constructing a redundant field screening mechanism based on track credibility and behavior stability dynamic evolution, the mode that a traditional platform only relies on field format legality verification is broken, an attacker is effectively prevented from constructing a pseudo-legal identity to be mixed into a sharing system, and the problems of system misjudgment and real identity misrecognition caused by reverse utilization of a redundant mechanism are solved.
Owner:刘聪
Rapid immunochromatography detection kit for gastrointestinal pathogenic bacteria based on viral nano-enzyme probe
The invention belongs to the technical field of biological detection, and discloses a rapid immunochromatography detection kit for gastrointestinal pathogenic bacteria based on a viral nano-enzyme probe. The invention discloses a nano-enzyme probe, the virus-shaped nano-enzyme probe provided by the invention takes Fe3O4 nano-particles as a core, Pt nano-particles and Au (at) Pt nano-particles are coated in sequence, a specific antibody is modified, and the nano-enzyme probe has a magnetic enrichment effect and a multi-catalytic-site characteristic at the same time; rapid capture and high-sensitivity quantitative detection of various gastrointestinal pathogenic bacteria in complex matrixes (river water samples, lake water samples and excrement samples) can be realized, and matrix interference in practical application is eliminated; and the kit has huge potential in the aspects of high-sensitivity field screening and clinical monitoring of infection of gastrointestinal bacteria (such as escherichia coli, salmonella and helicobacter pylori).
Owner:GUANGDONG GENERAL HOSPITAL
Platform trajectory data processing method and device, equipment and storage medium
The present application relates to the technical field of intelligent logistics, and particularly relates to a platform trajectory data processing method, device and equipment and a storage medium, wherein the method first acquires a logistics trajectory data set and a preset field screening rule, performs text extraction processing on the logistics trajectory data set to obtain a plurality of business scenario description texts, then calls a pre-trained feature selection model to perform field screening processing on each business scenario description text based on the field screening rule to obtain a target field set, calls a pre-trained semantic model to perform semantic coding and template matching processing on the target field set to obtain a template field mapping table, then performs similarity calculation and screening processing based on the template field mapping table to obtain a target template set, and finally performs copywriting generation processing on the target template set to obtain a target copywriting set, and determines an initial online copywriting based on the target copywriting set, aiming to improve the efficiency of e-commerce logistics trajectory data processing.
Owner:SHANGHAI DONGPU INFORMATION TECH CO LTD
A method and device for controlling spatial data with a custom range
The present invention discloses a method and device for controlling spatial data within a user-defined range, establishing a first association relationship between permission level information and permission range coordinates, establishing a second association relationship between users and permission level information, and obtaining a request format of the request when a target user requests a spatial data map service; determining a request type based on the request format, assigning a target permission processor based on the request type, and obtaining target spatial data within the permission range corresponding to the request based on the target permission processor and the second association relationship. The above process realizes the control of spatial data by establishing an association relationship between permission level information and users and permission range coordinates, no longer using a token mechanism and field screening to control permissions, and no longer requiring segmentation of slice services and image data, thereby avoiding the inconvenience of client maintenance and token update, data fragmentation, and redundancy, and reducing the cost of data production, update, and maintenance.
Owner:SHANGHAI SHUHUI SYST TECH CO LTD
Biological pesticide for preventing and treating aphanomyces cochlioides root rot and application thereof
The application discloses a kind of biological source pesticides for preventing and treating aigan's root rot, it includes one or more than two combinations of berberine, ningnanmycin, Sophora flavescens extract, zhongshengmycin, allicin, polyoxin, matrine, osthol, lentinan.The application takes aigan's root and rhizome infected with root rot as research object, obtains a strain of pathogenic bacteria from disease-healthy boundary by separation, purification and pathogenicity determination, and is identified as bean shell ball spores by morphological observation, rDNA-ITS sequence analysis Macrophomina phaseolina Comprehensive indoor and field screening results, the most effective pesticide screened includes 3% zhongshengmycin, 0.5% berberine, 3.5% Sophora flavescens extract and 8% ningnanmycin, and all does not show plant adverse effect and phytotoxicity to aigan growth.Especially, it can significantly reduce malondialdehyde level, while increasing the activity of superoxide dismutase, catalase and peroxidase, so as to improve the disease resistance of aigan.
Owner:NANJING UNIV OF TRADITIONAL CHINESE MEDICINE
On-site screening device for bulk materials in dumping site
Owner:KUNMING ENG & RES INST OF NONFERROUS METALLURGY
Method for inducing litchi girdling callus and peripheral bud differentiation in field
The invention discloses a method for inducing litchi girdling callus and peripheral bud differentiation in a field, and relates to the technical field of plant propagation, the method comprises the following steps: cutting off the top of a trunk branch of a litchi growing vertically, and carrying out spiral girdling below the section of the top until the girdling depth reaches a wood layer; soaking absorbent cotton in a bud differentiation inducer to obtain an induction matrix; after the top section and the girdling opening of the litchi branch are covered with the induction matrix, bud differentiation treatment is conducted on the litchi branch; after bud differentiation treatment is completed, the litchi branches are subjected to moisture preservation and light shielding treatment, and adventitious buds are obtained. According to the method, wound induction is directly carried out on the litchi plants in the field, the browning problem in the in-vitro culture process is avoided by utilizing a plant self-repairing mechanism and combining with local medicament treatment, adventitious bud differentiation around girdling openings is promoted, a stable material source is provided for field screening of the polyploidy plants, the equipment and labor cost is reduced, and the method is suitable for large-scale popularization and application. Meanwhile, the survival rate of genetic variants is improved.
Owner:SOUTH SUBTROPICAL CROP RES INST CHINA ACAD OF TROPICAL AGRI SCI
Test strip and kit for multi-item saliva detection of drugs
The invention discloses a test strip and a kit for multi-item saliva detection of drugs, and relates to the technical field of drug detection. The detection test strip comprises a bottom plate, and a sample pad, a combination pad, an NC membrane and an absorption pad which are sequentially arranged in the horizontal direction and connected end to end, the conjugate pad is coated with a gold-labeled monoclonal antibody; the NC membrane is sequentially provided with a coating line, a detection line and a quality control line along the chromatography direction, the coating line is coated with a drug antigen, the detection line is coated with a secondary antibody aiming at a drug immune complex, and the quality control line is coated with a goat anti-chicken IgY antibody. The coating line for coating and fixing the drug antigen is additionally arranged at the front end of the NC membrane, so that the free gold-labeled monoclonal antibody is intercepted, background interference and background signals are reduced, it is ensured that only a gold-labeled compound really combined with the drug can reach the T line for color development, and the possibility of false positive is reduced. Meanwhile, a color developing signal (T line existence / absence) is visually corresponding to a detection result (positive / negative), so that the misreading risk is remarkably reduced, and the user experience and the field screening efficiency are improved.
Owner:SHENZHEN AIVD BIOTECH INC
Education knowledge graph construction method and system based on large model
The invention specifically discloses an educational knowledge graph construction method and system based on a large model, and the method comprises the following steps: collecting and marking a plurality of educational domain data sets from textbooks and networks, carrying out the preprocessing, constructing an entity recognition NER model based on a space framework, collecting the data of a to-be-constructed domain, inputting the data into a trained ner pipeline, and carrying out the construction of a plurality of educational domain data sets. Outputting a preliminary entity list; adding a large language model pipeline, performing specific field screening on the initial entity list, and extracting attributes of screened entities; extracting context texts of the screened knowledge point entities, converting the context texts into entity vectors, calculating cosine similarity between any two entity vectors, and judging relation types between entity pairs, including an incidence relation, a pre-relation and a post-relation; all sentences of the subject data needing to be constructed are extracted, and the educational knowledge graph is constructed. By adopting the technical scheme, the large model is utilized to accurately and quickly construct the educational knowledge graph, and the definition of the educational knowledge graph is met.
Owner:SOUTHWEST UNIV
A construct for mediating maize male sterility and use thereof
ActiveCN119753006BFermentationVector-based foreign material introductionBiotechnologyHerbicide resistance
The present application relates to the field of molecular crop breeding, and relates to a construct for mediating maize male sterility and application thereof, the construct comprising four functional element expression cassettes, namely a red fluorescent gene DsRed expression cassette, a male fertility restoration gene MS45 expression cassette, a tassel pollen lethal gene ZmAmylase expression cassette and a glufosinate-ammonium herbicide tolerance gene PAT expression cassette. The seed of the offspring plant with the specific construct obtained by the present application can be directly observed by naked eyes under the condition of not using other equipment, and the seed has glufosinate-ammonium herbicide resistance, so that the screening mode is greatly simplified, and a large amount of labor cost is saved; meanwhile, the herbicide resistance is generated, which has an important role for field screening or killing weeds.
Owner:LONGPING BIOTECHNOLOGY (HAINAN) CO LTD
A method for identifying temperature-driven structural parameters based on uncertainty sampling
The present invention discloses a temperature-driven structural parameter identification method based on uncertainty sampling, which relates to the field of structural health monitoring technology. To address the shortcomings of existing structural parameter identification methods, such as sensitivity to environmental interference, low computational efficiency, and insufficient uncertainty quantification, the invention uses temperature as a natural excitation source. By establishing an initial finite element model, the temperature change of the structural surface and the temperature-induced static response data are simultaneously collected. After data preprocessing and steady-state uniform temperature field screening, highly sensitive structural parameters are screened based on parameter perturbation analysis. The transition extended Markov chain Monte Carlo algorithm is used to sample the posterior distribution, and the computational complexity of the high-dimensional parameter space is reduced through the intermediate distribution transition mechanism. The final output is the parameter posterior expectation and covariance matrix. This method does not require artificial excitation, significantly improves long-term monitoring efficiency and damage identification reliability, and is suitable for the condition assessment and safety diagnosis of civil engineering structures such as bridges and spatial steel structures.
Owner:TIANJIN UNIVERSITY OF SCIENCE & TECHNOLOGY ASSET MANAGEMENT CO LTD +1
A method for dynamically controlling a data center cooling system based on AI
ActiveCN121728754BDesign optimisation/simulationEnergy efficient computingCold airTemperature control
The present application relates to the technical field of data center cooling, and particularly relates to a method for dynamically controlling a data center cooling system based on AI, comprising: data acquisition; hot field screening; temperature deviation calculation; risk equipment identification; cooling equipment classification; first regulation amount generation; second regulation amount generation; basic regulation amount generation; and regulation instruction generation. The present application identifies the cooling equipment that is locally uneven in cooling and heat, screens potential risk equipment based on multi-parameter dynamic correlation and historical normal mode to calculate abnormal probability, and generates a global basic regulation amount in combination with a preset AI model to generate a final regulation instruction, so as to ensure intelligent control of the cooling system when coping with non-uniform distribution of loads and non-synergistic operation of single-point temperature control, and effectively solve the problems of non-synergistic competition of cooling equipment, short circuit of hot and cold air flow, coexistence of local overheating and overcooling, and high overall energy consumption caused by non-uniform distribution of load spaces and non-synergistic operation of single-point temperature control.
Owner:CHONGQING YINGFAN TECH CO LTD
Shared mobile charging system and method
The invention relates to the technical field of charging facilities, and discloses a shared mobile charging system and method, and the system comprises a control execution module, an environment modeling module, a demand prediction module, a thermal field screening module, an optimization decision module, and a scheduling interlocking module. The environment modeling module establishes digital mapping of parking space, power grid phase and access cost; the demand prediction module calculates the predicted occupation duration of the vehicle; the thermal field screening module is used for eliminating thermal risk parking spaces based on neighborhood accumulated thermal potential energy; the optimization decision module determines an optimal target parking space in combination with space-time matching and power grid balance cost; the dispatching interlocking module generates a speed adjusting instruction according to the predicted arrival time difference of the vehicle and the mobile power supply unit so as to achieve time-space synchronization, and executes power derating according to a pre-starting signal of a stereo garage motor so as to achieve transient protection. According to the invention, active adjustment of the three-phase load of the power grid, avoidance of local heat accumulation and cooperative control of an electromechanical system are realized through multi-dimensional optimization and a dual interlocking mechanism.
Owner:KUNSHAN HENGJU ELECTRONIC CO LTD
Method for dynamically controlling data center cooling system based on AI
ActiveCN121728754ADesign optimisation/simulationEnergy efficient computingCold airTemperature control
The invention relates to the technical field of data center cooling, in particular to a method for dynamically controlling a data center cooling system based on AI. Performing thermal field screening; calculating temperature deviation; identifying risk equipment; classifying cooling equipment; generating a first regulation and control quantity; generating a second regulation quantity; generating basic regulation and control quantity; and generating a regulation and control instruction. According to the method, the concerned cooling equipment with local uneven cold and heat is identified, the abnormal probability is calculated based on the multi-parameter dynamic relevancy and the historical normal mode so as to screen the potential risk equipment, the global basic regulation and control quantity is generated in combination with the preset AI model, and the final regulation and control instruction is generated; the intelligent control is ensured when the cooling system deals with load non-uniform distribution and single-point temperature control non-cooperative operation, and the problems of non-cooperative competitive output, cold and hot air flow short circuit, local overheating and supercooling coexistence and high overall energy consumption between cooling devices caused by load space non-uniform distribution and single-point temperature control non-cooperative operation are effectively solved.
Owner:CHONGQING YINGFAN TECH CO LTD
InDel molecular marker of bcapx6 gene, primer and application thereof
The application provides an InDel molecular marker of BcAPX6 gene, primers and application thereof, an upstream primer of the InDel molecular marker sequence is CTCCTCTCTCTGAGAGTAGAC, and a downstream primer is GTTTAAAGAAGAAGAAGAGTGGC. The molecular marker is verified by using 39 parts of Brassica chinensis var. communis germplasm. The APX6 Indel can be used for assisted breeding of genes, and is used for identifying ascorbic acid content of the Brassica chinensis var. communis, so that field screening work is reduced, breeding cost is reduced, and breeding progress is accelerated, and has high practical value. The application is beneficial to establishment of a high ascorbic acid content marker assisted breeding system of the Brassica chinensis var. communis, and can be simply, quickly and high-throughput applied to breeding practice of the Brassica chinensis var. communis.
Owner:NANJING AGRICULTURAL UNIVERSITY
SNP (Single Nucleotide Polymorphism) molecular marker related to salt tolerance character of broad beans and application of SNP molecular marker
PendingCN120945119AMicrobiological testing/measurementDNA/RNA fragmentationFluorescent pcrGenetic stock
The invention relates to the technical field of molecular genetic breeding, in particular to an SNP molecular marker related to the salt tolerance character of broad beans and application. The SNP molecular marker is located on a No.4 chromosome chr4-919763028 of a broad bean genome, and a base polymorphism site is G / T; according to the method, to-be-detected broad bean genome DNA (deoxyribonucleic acid) is extracted, the primer pair SNP molecular marker is used for fluorescent PCR (polymerase chain reaction) detection, the genotype of the broad bean is determined, and the salt tolerance of a broad bean individual with the genotype of GG is higher than that of a broad bean individual with the genotype of TT; the broad bean salt-tolerant character related molecular marker is developed and applied to early-maturing variety breeding to identify or assist in identifying broad bean salt-tolerant varieties, field screening of salt-tolerant broad bean breeding materials is facilitated, and the broad bean breeding process is accelerated.
Owner:JIANGSU ACAD OF AGRI SCI
An Indel molecular marker primer for identifying the length of cotton vegetative branches, its identification method, and its application.
PendingCN122081548AMicrobiological testing/measurementDNA/RNA fragmentationBiotechnologyElectrophoreses
This invention provides an Indel molecular marker primer for identifying the length of cotton vegetative branches, along with its identification method and application, belonging to the field of cotton molecular marker technology. The nucleotide sequences of the upstream and downstream primers of the Indel molecular marker primer described in this invention are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively. Using these primers, PCR amplification of genomic DNA from cotton samples is performed, and the amplified products are detected by electrophoresis. If no amplified band is observed, the haplotype of the cotton sample is HapA, indicating short vegetative branch cotton (<25.5 cm); if a band of 401 bp is amplified, the haplotype of the cotton sample is HapB, indicating long vegetative branch cotton (>31.0 cm). The Indel molecular marker and primers of this invention can be used in marker-assisted breeding, helping to reduce field screening, lower breeding costs, and shorten the breeding cycle, thus possessing significant application value.
Owner:INST OF COTTON RES CHINESE ACAD OF AGRI SCI