Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

36 results about "Citrus tristeza virus" patented technology

Citrus tristeza virus (CTV) is a viral species of the genus Closterovirus that causes the most economically damaging disease to its namesake plant genus, Citrus. The disease has led to the death of millions of Citrus trees all over the world and has rendered millions of others useless for production. Farmers in Brazil and other South American countries gave it the name "tristeza", meaning sadness in Portuguese and Spanish, referring to the devastation produced by the disease in the 1930s. The virus is transmitted most efficiently by the brown citrus aphid.

Citrus scion pretreatment technology for promoting removal of composite infection pathogens

The invention discloses a citrus scion pretreatment technology for promoting removal of composite infection pathogens. The citrus scion pretreatment technology includes acquiring citrus branches, pruning the citrus branches to remove leaves and leaf stalks and disinfecting the surfaces of the citrus branches by the aid of sodium hypochlorite (NaClO) aqueous solution; detecting molecules of scions of the citrus branches with the disinfected surfaces; performing detoxification treatment on scion materials by the aid of insecticides if the detected citrus branches are infected by HLB (huanglongbing) viruses and CTV (citrus tristeza viruses), acquiring virus-free shoots and completing the citrus scion pretreatment detoxification step. The citrus scion pretreatment technology has the advantages that the citrus branches are treated by the aid of small-molecule bactericide triclosan (TCL) and a plurality of antibiotics, so that virus-free stem tip materials without the citrus tristeza viruses (CTV) and huanglongbing (HLB) pathogens can be acquired; the detoxification efficiency is high, and a good effect can be realized; the virus-free stem tip materials can be provided for further stem tip micro-shoot grafting or tender-shoot grafting.
Owner:HUAZHONG AGRI UNIV

Real time fluorescence reverse transcription polyase chain reaction solid phase reagent kit with one-step method of citrus decline virus and testing method thereof

The invention relates to a solidification examination reagent box of one-step real-time fluorescence quantitative reverse transcription polymerase chain reaction for Citrus Tristeza Virus and a method of utilizing the reagent box to detect Citrus Tristeza Virus, which is a fluorescence quantitative detection method and product of especially establishing for Citrus Tristeza Virus. The detection time only need 4 hours and the method has the high specificity, the high sensitivity and the stability and reliability. The method overcomes the shortcomings of the high erroneous recognition and the low sensitivity of serological method for Citrus Tristeza Virus of the conventional diagnosis method according to symptomatology, is suitable for the rapid diagnosis of the viral existence of Citrus seedling and viruliferous insect sector, and can be used in quality inspection of citrus seedling and identification of Citrus Tristeza Virus.
Owner:CHONGQING UNIV

One-step multi-PCR detection method for simultaneously detecting four important citrus pathogenies

The invention discloses a one-step multi-PCR detection method for simultaneously detecting four important citrus pathogenies. According to the method, primers for the four important pathogenies including Citrus tristeza virus, Citrus exocortis viroid, Citrus tatter-leaf virus and Liberobacter asiaticum spreading through grafting are preferably selected, and primer concentration, PCR amplificationcondition and the like are optimized, therefore, the four important citrus pathogenies spreading through grafting can be simultaneously detected. The detection method provided by the invention is quick and accurate, has the advantages of good detection stability, high specificity and high consistency, is suitable for large-scale generalization, and can be used for guiding the introduction of varieties and generalization of detoxifying treatment of seedlings to ensure the safe production of citrus; in addition, by adopting the detection method, repeated detection in the conventional PCR is avoided.
Owner:CITRUS RES INST OF CHINESE ACAD OF AGRI SCI

Method for preventing citrus tristeza virus of fruit bearing production type citrus trees

The invention belongs to the technical field of plant disease and insect pest control, and particularly discloses a method for preventing the citrus tristeza virus. The method is especially suitable for preventing the citrus tristeza virus of fruit bearing production type citrus trees. According to the method, through special management of spring shoots, summer shoots, early and late autumn shoots and winter shoots of the citrus trees every year, the food sources and breeding sites of citrus psylla spreading the citrus tristeza virus can be effectively eliminated so that eggs and nymphs can not grow and develop normally, the number of subcultured pest sources is reduced greatly, and then an ideal preventing effect is realized; meanwhile, the usage amount of insecticides can be reduced, natural enemy protection is achieved, and prevention cost is reduced; furthermore, compared with the shoot control scheme, the method has the advantages that the growth of the citrus trees is not affected, and the effect of eliminating the food sources and breeding sites of citrus psylla spreading the citrus tristeza virus is remarkable.
Owner:ZHONGKAI UNIV OF AGRI & ENG

Composite microbial agent for citrus tristeza virus, preparation method thereof and special biological agent for citrus tristeza virus prepared by using same

The invention relates to the technical field of agricultural planting, in particular to a composite microbial agent for citrus tristeza virus, a preparation method thereof and a special biological agent for the citrus tristeza virus prepared by using the same. According to the invention, bacillus thuringiensis, beauveria bassiana and trichoderma harzianum are used to control the pathogen of citrustristeza virus pathogens on the ground and kill a spreading source wood louses and eggs thereof so as to effectively control the occurrence of the citrus tristeza virus, and four kinds of microorganism bacteria underground can effectively control the invasion of pathogenic microorganisms, effectively control the spread of pathogenic bacteria by nematodes, and simultaneously regulate the soil structure, decompose organic matters and improve the soil fertility. By promoting the growth of citrus roots with citrus specific AM fungi, citrus can grow new roots in clusters, the number of the new roots is enlarged, the tree vigor is enhanced, the immunity and disease resistance of trees are improved, a nitrogen fixation system is formed, and the pathogen control is combined with the improvement of the ecological environment for the growth of the citrus to achieve the effect of preventing and treating the citrus tristeza virus.
Owner:广西青又青生物肥业有限公司

Planting method for controlling infection of citrus tristeza virus on newly-grown citrus seedlings

InactiveCN105028108AEffective prevention and controlSolve technical problems in management workCultivating equipmentsDiseaseShoot
The invention discloses a planting method for controlling the infection of the citrus tristeza virus on newly-grown citrus seedlings. The planting method includes the steps that terrestrial citrus seedlings are loaded with a nutrition pot filled with nutrition soil or field soil, then the nutrition pot loaded with the terrestrial citrus seedlings is put into a greenhouse to be cultivated in a centralized mode or centralized in farmland to be cultivated, a black mulching film or a light reflecting mulching film is used for covering the ground of the farmland, the farmland is relatively independent, and citrus planting does not exist in the far peripheral range; the young shoot emerging time, the shoot emerging amount and the young shoot growing height of each batch are recorded; the pest and disease damage occurrence on the citrus seedlings is regularly detected, spraying preventing and controlling are conducted purposefully, a diaphorina citri killing pesticide is sprayed in the shoot stage, meanwhile, pests such as aphids and leaf miners are controlled, and disease preventing and controlling are conducted according to a conventional method; the tristeza virus is detected every year, and if trees infected with the tristeza virus are found, the tristeza virus infected with the tristeza virus are removed immediately; the citrus seedlings are fixedly planted into a field after two years. The planting method can effectively lower the risk of infecting the citrus tristeza virus and even eliminate the citrus tristeza virus.
Owner:GUANGDONG INST OF APPLIED BIOLOGICAL RESOURCES

Efficient and comprehensive citrus tristeza virus prevention and control technology

The invention discloses an efficient and comprehensive citrus tristeza virus prevention and control technology, and relates to the field of plant disease and insect pest prevention and control, in particular to a citrus tristeza virus prevention and control technology. The technology includes the following steps of firstly, rapidly cleaning an ill tree through a five-step method; secondly, replanting safe big seedlings heeled in a net house; thirdly, precisely and efficiently preventing and controlling diaphorina citri in the five key periods; fourthly, establishing a mechanism with overall prevention and treatment in large areas and 'central householder system' joint prevention and control in small areas; fifthly, planting a fir prevention and isolation belt. The citrus tristeza virus incidence rate of a fruit garden can be effectively controlled, economic loss is directly reduced, the income of fruit farmers is improved, meanwhile the pesticide prevention and treatment frequency andprevention and treatment cost for the diaphorina citri can be reduced, and therefore the pesticide surface source contamination is reduced, and the technology has remarkable economic, social and ecological benefits.
Owner:赣州市果树植保站 +1

Rapid detection method of citrus decay virus by rt-lamp

The invention belongs to the field of biotechnology and discloses an RT-LAMP detection method for citrus tristeza viruses. Based on RT-LAMP and the gene sequence of different stains of CTV issued by GenBank, four specific primers required by the RT-LAMP detection method are designed in accordance with the conserved regions of the sequences of the viruses, and the sequences of the four primers areshown below: F3: CGAAGTGGATTTGTCTGACA; B3: GGAATCCCTGCATCTAGCG; FIP:ACTCGAAGGGCGTTAGTACGGCTTTGGACTGACGTCGTGTT; and BIP: CTGGGGTAGGACTAACGATGCCGACGTCCGCCATAACTCAA. The four primers are completely matched with 6 regional sequences in a target sequence respectively. Experiment results indicate that the sensitivity of the method is 100 times higher than a common reverse transcription-polymerase chainreactions (RT-PCR) method and has high virus early diagnosis accuracy. The result obtained by the method is consistent with that obtained by the RT-PCR detection method, but more sensitive and accurate than that obtained by a direct tissue blot immuno-assay (DTBIA) method. The method can quickly, accurately and sensitively detect CTV, and is suitable for quick detection of a sample, CTV spread monitoring, virus-free seedling identification and tristeza virus identification.
Owner:CITRUS RES INST OF CHINESE ACAD OF AGRI SCI

Citrus orchard conducive pest control planting method

The invention belongs to the field of citrus planting, and particularly relates to a citrus orchard conducive pest control planting method. Guava fruiters are planted in a citrus orchard to increase the population quantity of phytoseiid mites in the citrus orchard, an independent environment is formed, citruses are planted, the periphery of each citrus tree is enclosed by the guava fruiters to form double barriers in a checkered manner, petroleum oils are sprayed in a matched manner, and pest control is fundamentally performed in the citrus planting process. According to the citrus orchard conducive pest control planting method, based on the capability of naturally breeding the phytoseiid mites by the planted guava fruiters, the guava fruiters and the citrus trees are planted in the checkered manner, the citruses are planted after the guava fruiters form crowns, and the petroleum oils are sprayed to control citrus tristeza viruses. The pest control function of natural enemies is a direct effective means for killing sole insect-borne citrus psyllas of citrus tristeza virus transmission pathogens in citrus planting.
Owner:GUANGDONG INST OF APPLIED BIOLOGICAL RESOURCES

Construction method and kit of full-length infectious clone of citrus tristeza virus

The invention discloses a construction method and a kit of a full-length infectious clone of citrus tristeza virus and belongs to the technical field of biology. The invention designs six pairs of specific primers against the complete sequence of a citrus tristeza virus separated strain FS-577, and the amplification region of the primers covers the complete sequence of the FS-577. Compared with a wild type FS-577, the full-length infectious clone obtained after an amplification fragment is subjected to double enzyme digestion and then sequentially inserted into a binary vector pUC119-delta 9 after transformation has completely consistent sequence, infection ability, host range and other characters. The kit established by utilizing the method comprises first chain cDNA (complementary deoxyribonucleic acid) synthesis, PCR (polymerase chain reaction) amplification and double enzyme digestion buffer solutions, a link reaction buffer solution and the like, and the kit can be used for constructing the full-length infectious clone of the citrus tristeza virus. According to the construction method, a very important technical platform is provided for researching pathopoiesis, aphid transmission and other mechanisms of the citrus tristeza virus and controlling citrus tristeza disease.
Owner:CITRUS RES INST OF CHINESE ACAD OF AGRI SCI

Pine needle organic fertilizer and preparation method and application thereof

The invention relates to an organic fertilizer and relates to a preparation method and application thereof. According to a pine needle organic fertilizer, an organic solvent extract of pine needles serves as an effective component and is prepared into emulsifiable concentrate or water-soluble organic fertilizer or granular fertilizer. The fertilizer is applied before fruit trees flower, the quality in the flowering stage can be improved, the quality of fruits is improved, the dried matter content is increased, the sugar content is increased, and early maturing and late harvesting are promoted. The fertilizer can be used for treating citrus tristeza viruses. The fertilizer is used in the seedling stage of vegetables and used for reducing the root-rot disease and defoliator pest. The fertilizer is used before tea sprouting, the number of sprouts is increased, tender shoots become thicker, tender leaves become thicker, the yield of tea leaves is obviously increased, and the quality of the tea leaves is remarkably improved.
Owner:广东溪澜有机农业发展有限公司 +1

Preventing and treating method for citrus tristeza virus

The invention provides a preventing and treating method for citrus tristeza virus. The method comprises the following steps: S4, carrying out spraying and root-irrigation of a diluted biological plantprotection agent every 48-96 hours to citrus and carrying out root-irrigation and tree washing of the diluted plant protection agent, applying an efficient organic fertilizer and a liquid fertilizerat the same time, and carrying out operations continuously for 2-4 hours; S5, carrying out spraying and root-irrigation of the diluted biological plant protection agent every 10-20 days, and carryingout root-irrigation and tree washing of the diluted plant protection agent at the same time; and S6, fully spraying the diluted biological plant protection agent every one month finally and carrying out root-irrigation of the diluted biological plant protection agent at the same time.
Owner:YIZHITAI BIOTECH LONGYAN CO LTD

Multi-RT-PCR (reverse transcription-polymerase chain reaction) method for simultaneously detecting citrus yellow vein clearing viruses and citrus tristeza viruses and application of multi-RT-PCR method

The invention relates to a multi-RT-PCR (reverse transcription-polymerase chain reaction) method for simultaneously detecting citrus yellow vein clearing viruses and citrus tristeza viruses. The multi-RT-PCR method has the advantages that Mg<2+> and dNTP (diethyl-nitrophenyl thiophosphate) concentration, primer concentration and annealing temperatures which can affect multi-PCR are adjusted and optimized by the aid of selected specific primers of conserved sequences and reference genes of coat proteins of two types of pathogens of the CYVCV (citrus yellow vein clearing viruses) and the CTV (citrus tristeza viruses), the one-step multi-RT-PCR method for simultaneously detecting the CYVCV and the CTV can be created, and the sensitivity of the multi-RT-PCR method is consistent with single RT-PCR detection sensitivity; as shown by results of detection on 33 field samples by the aid of the multi-RT-PCR method, the CYVCV and CTV infection rates are 54.5% and 66.7% respectively, and 36.4% of samples are infected in a mixed manner; the multi-RT-PCR method can be used for simultaneously quickly detecting the CYVCV and the CTV in large quantities of field samples and has important significance on improving efficient and accurate detection and timely and effective prevention and control on the citrus yellow vein clearing viruses and the citrus tristeza viruses.
Owner:SOUTHWEST UNIVERSITY

Construction method and kit of full-length infectious clone of citrus tristeza virus

The invention discloses a construction method and a kit of a full-length infectious clone of citrus tristeza virus and belongs to the technical field of biology. The invention designs six pairs of specific primers against the complete sequence of a citrus tristeza virus separated strain FS-577, and the amplification region of the primers covers the complete sequence of the FS-577. Compared with a wild type FS-577, the full-length infectious clone obtained after an amplification fragment is subjected to double enzyme digestion and then sequentially inserted into a binary vector pUC119-delta 9 after transformation has completely consistent sequence, infection ability, host range and other characters. The kit established by utilizing the method comprises first chain cDNA (complementary deoxyribonucleic acid) synthesis, PCR (polymerase chain reaction) amplification and double enzyme digestion buffer solutions, a link reaction buffer solution and the like, and the kit can be used for constructing the full-length infectious clone of the citrus tristeza virus. According to the construction method, a very important technical platform is provided for researching pathopoiesis, aphid transmission and other mechanisms of the citrus tristeza virus and controlling citrus tristeza disease.
Owner:CITRUS RES INST OF CHINESE ACAD OF AGRI SCI

Citrus tristeza virus and citrus exocortis viroid dual detection kit and application thereof

ActiveCN106244732ASimple and reliable absolute quantificationAbsolute quantitative realizationMicrobiological testing/measurementDNA/RNA fragmentationPositive controlRNA extraction
The invention discloses a citrus tristeza virus and citrus exocortis viroid dual detection kit and application thereof, and designs a dual digital PCR quantitative detection reagent composition for citrus tristeza viruses and citrus exocortis viroids. The kit contains a virus sample RNA extraction reagent, a cDNA reverse transcription synthesis reagent, a digital PCR reagent, a citrus decline and citrus exocortis positive control sample template and a citrus decline and citrus exocortis negative control sample template. The kit has the advantages of high specificity, higher impurity interference resistance, convenience, high speed, detection sensitivity equivalent to that of an existing real-time fluorescent quantitative PCR detection method and the like when being used for detecting the citrus tristeza viruses and the citrus exocortis viroids, and can be used for early qualitative and quantitative detection of the citrus tristeza viruses and the citrus exocortis viroids, epidemiological survey and the like.
Owner:PLANT PROTECTION RES INST OF GUANGDONG ACADEMY OF AGRI SCI

Method for identifying citrus tristeza virus in field

The invention belongs to the technical field of fruit tree plant disease and insect pest identification, and particularly relates to a method for identifying citrus tristeza virus in a field. The method for identifying citrus tristeza virus in the field comprises the following steps that 1, before a suspected tree suffering from citrus tristeza virus is felled or excavated, old and sick branches are gently pruned, annular ditching and fertilizer application are performed two times along a crown water drip line, burying and earthing are performed, orchard cleaning and fertilizer application are performed one time in winter, and fertilizer application is performed one time after second-time physiological fruit dropping; 2, the colors of tip leaves of three batches in spring, summer and winter are observed after fertilizer application; 3, when fruits are ripened at the end of the year, and shapes and colors of fruits are observed. The method for identifying citrus tristeza virus in advance during root fertilizer application is adopted for replacing an existing method for uniformly pruning all suspected trees suffering from citrus tristeza virus, and the method has the advantages of being safe, simple and low in cost.
Owner:广西壮族自治区农业科学院园艺研究所

Rearing method of non-toxic brown citrus aphids for researching virus transmission molecular mechanism

The invention discloses a rearing method of non-toxic brown citrus aphids for researching a virus transmission molecular mechanism. The method comprises the following steps of: performing continuous rearing by utilizing non-toxic citrus seedlings to obtain the non-toxic wingless brown citrus aphids, preparing a rearing solution, sterilizing, and preparing and rearing in a rearing room. According to the method, the formation of the winged adult aphids is effectively inhibited, the obtainment of the annual non-toxic and wingless adult aphids is realized and the standardization of experimental test insects is ensured by adjusting the number of the wingless adult aphids and next-generation nymphs on non-toxic citrus seedlings. The rearing solution used in the method disclosed by the invention is simple and easy to prepare, the short-term normal survival of the wingless adult aphids after deviating from host plants is realized, the virus transmission efficiency is not affected, and the method is suitable for the requirements for researching the aphid transmission citrus tristeza virus molecular mechanism.
Owner:CITRUS RES INST OF CHINESE ACAD OF AGRI SCI

A multiplex RT-PCR method for the simultaneous detection of citrus yellow vein bright virus and decay virus and its application

The invention relates to a multi-RT-PCR (reverse transcription-polymerase chain reaction) method for simultaneously detecting citrus yellow vein clearing viruses and citrus tristeza viruses. The multi-RT-PCR method has the advantages that Mg<2+> and dNTP (diethyl-nitrophenyl thiophosphate) concentration, primer concentration and annealing temperatures which can affect multi-PCR are adjusted and optimized by the aid of selected specific primers of conserved sequences and reference genes of coat proteins of two types of pathogens of the CYVCV (citrus yellow vein clearing viruses) and the CTV (citrus tristeza viruses), the one-step multi-RT-PCR method for simultaneously detecting the CYVCV and the CTV can be created, and the sensitivity of the multi-RT-PCR method is consistent with single RT-PCR detection sensitivity; as shown by results of detection on 33 field samples by the aid of the multi-RT-PCR method, the CYVCV and CTV infection rates are 54.5% and 66.7% respectively, and 36.4% of samples are infected in a mixed manner; the multi-RT-PCR method can be used for simultaneously quickly detecting the CYVCV and the CTV in large quantities of field samples and has important significance on improving efficient and accurate detection and timely and effective prevention and control on the citrus yellow vein clearing viruses and the citrus tristeza viruses.
Owner:SOUTHWEST UNIV

Reverse transcription-loop mediated isothermal amplification (RT-LAMP) quick detection method of citrus tristeza viruses (CTV)

The invention belongs to the field of biotechnology and discloses an RT-LAMP detection method for citrus tristeza viruses. Based on RT-LAMP and the gene sequence of different stains of CTV issued by GenBank, four specific primers required by the RT-LAMP detection method are designed in accordance with the conserved regions of the sequences of the viruses, and the sequences of the four primers areshown below: F3: CGAAGTGGATTTGTCTGACA; B3: GGAATCCCTGCATCTAGCG; FIP:ACTCGAAGGGCGTTAGTACGGCTTTGGACTGACGTCGTGTT; and BIP: CTGGGGTAGGACTAACGATGCCGACGTCCGCCATAACTCAA. The four primers are completely matched with 6 regional sequences in a target sequence respectively. Experiment results indicate that the sensitivity of the method is 100 times higher than a common reverse transcription-polymerase chainreactions (RT-PCR) method and has high virus early diagnosis accuracy. The result obtained by the method is consistent with that obtained by the RT-PCR detection method, but more sensitive and accurate than that obtained by a direct tissue blot immuno-assay (DTBIA) method. The method can quickly, accurately and sensitively detect CTV, and is suitable for quick detection of a sample, CTV spread monitoring, virus-free seedling identification and tristeza virus identification.
Owner:CITRUS RES INST OF CHINESE ACAD OF AGRI SCI

Expression vector construction method and kit of citrus tristeza virus

The invention discloses an expression vector construction method of citrus tristeza virus. The invention designs four pairs of specific primers, namely ZYC349 / ZYC350, ZYC357 / ZYC358, ZYC412 / ZYC415 and ZYC479 / ZYC480, the primers can be used for amplifying genes containing exogenous green fluorescent proteins, driving a translated citrus tristeza virus p23 gene promoter, further inserting a fragment after connection into a terminal of a p23 gene in a full-length infectious clone 35S-148 of the citrus tristeza virus by double enzyme digestion and further ensures that the citrus tristeza virus is used as an expression vector to realize stable and high-efficient expression of green fluorescent protein genes in nicotiana benthamiana for above 2 months. According to the expression vector construction method, a very important technical platform is provided for researching the distribution and the movement of the citrus tristeza virus in plants and being used as a biological reactor to realize mass expression of the high-quality proteins.
Owner:CITRUS RES INST OF CHINESE ACAD OF AGRI SCI

Citrus tristeza virus based vectors for foreign gene/s expression

Disclosed herein are viral vectors based on modifications of the Citrus Tristeza virus useful for transfecting citrus trees for beneficial purposes. Included in the disclosure are viral vectors including one or more gene cassettes that encode heterologous polypeptide s. The gene cassettes are positioned at desirable locations on the viral genome so as to enable expression while preserving functionality of the virus. Also disclosed are methods of transfecting plants and plants transfected with viral vector embodiments.
Owner:UNIV OF FLORIDA RES FOUNDATION INC

Method for rapidly detecting citrus tristeza virus by electrospray ionization mass spectrometry

The invention provides a method for rapidly detecting citrus tristeza virus by electrospray ionization mass spectrometry. The electrospray ionization mass spectrometry is used to determine the changeof metabolites in citrus leaves, and the infected citrus nursery stocks at the early stage of the incubation period of tristeza virus can be identified prior to a routine detection method such as PCRbeing difficult to effectively detect the infected nursery stocks by combining a principal component analysis method. In a laboratory, samples are tested for 30 times, the detection result can reach 98%, during the field test, the samples are detected for 100 times, and the detection effect can reach 90%, so that the citrus tristeza virus can be effectively and rapidly detected.
Owner:NANCHANG UNIV

Rearing method of non-toxic brown citrus aphids for researching virus transmission molecular mechanism

The invention discloses a rearing method of non-toxic brown citrus aphids for researching a virus transmission molecular mechanism. The method comprises the following steps of: performing continuous rearing by utilizing non-toxic citrus seedlings to obtain the non-toxic wingless brown citrus aphids, preparing a rearing solution, sterilizing, and preparing and rearing in a rearing room. According to the method, the formation of the winged adult aphids is effectively inhibited, the obtainment of the annual non-toxic and wingless adult aphids is realized and the standardization of experimental test insects is ensured by adjusting the number of the wingless adult aphids and next-generation nymphs on non-toxic citrus seedlings. The rearing solution used in the method disclosed by the invention is simple and easy to prepare, the short-term normal survival of the wingless adult aphids after deviating from host plants is realized, the virus transmission efficiency is not affected, and the method is suitable for the requirements for researching the aphid transmission citrus tristeza virus molecular mechanism.
Owner:CITRUS RES INST OF CHINESE ACAD OF AGRI SCI

The technology of citrus scion pretreatment to promote the removal of complex infection pathogens

The invention discloses a citrus scion pretreatment technology for promoting removal of composite infection pathogens. The citrus scion pretreatment technology includes acquiring citrus branches, pruning the citrus branches to remove leaves and leaf stalks and disinfecting the surfaces of the citrus branches by the aid of sodium hypochlorite (NaClO) aqueous solution; detecting molecules of scions of the citrus branches with the disinfected surfaces; performing detoxification treatment on scion materials by the aid of insecticides if the detected citrus branches are infected by HLB (huanglongbing) viruses and CTV (citrus tristeza viruses), acquiring virus-free shoots and completing the citrus scion pretreatment detoxification step. The citrus scion pretreatment technology has the advantages that the citrus branches are treated by the aid of small-molecule bactericide triclosan (TCL) and a plurality of antibiotics, so that virus-free stem tip materials without the citrus tristeza viruses (CTV) and huanglongbing (HLB) pathogens can be acquired; the detoxification efficiency is high, and a good effect can be realized; the virus-free stem tip materials can be provided for further stem tip micro-shoot grafting or tender-shoot grafting.
Owner:HUAZHONG AGRI UNIV

A kind of pine needle leaf organic fertilizer and its preparation method and application

The present invention relates to an organic fertilizer, a preparation method therefor and a use thereof. A pine needle organic fertilizer is emulsifiable concentrate or water-soluble organic fertilizer or granular fertilizer which contains an organic solvent extract of pine needles as an effective component. The fertilizer is applied before fruit trees flower, the quality in the flowering stage and the quality of fruits can be improved, the dried matter content is increased, the sugar content is increased, and early maturing and late harvesting are promoted. The fertilizer can be used for treating citrus tristeza viruses. The fertilizer is used for reducing the root-rot disease and defoliator pest in the seedling stage of vegetables. The fertilizer is used before tea sprouting, the number of sprouts is increased, tender shoots and tender leaves become thicker, and the yield and the quality of the tea leaves are remarkably improved.
Owner:广东溪澜有机农业发展有限公司 +1

A Field Identification Method for Citrus Huanglongbing

The invention belongs to the technical field of fruit tree plant disease and insect pest identification, and particularly relates to a method for identifying citrus tristeza virus in a field. The method for identifying citrus tristeza virus in the field comprises the following steps that 1, before a suspected tree suffering from citrus tristeza virus is felled or excavated, old and sick branches are gently pruned, annular ditching and fertilizer application are performed two times along a crown water drip line, burying and earthing are performed, orchard cleaning and fertilizer application are performed one time in winter, and fertilizer application is performed one time after second-time physiological fruit dropping; 2, the colors of tip leaves of three batches in spring, summer and winter are observed after fertilizer application; 3, when fruits are ripened at the end of the year, and shapes and colors of fruits are observed. The method for identifying citrus tristeza virus in advance during root fertilizer application is adopted for replacing an existing method for uniformly pruning all suspected trees suffering from citrus tristeza virus, and the method has the advantages of being safe, simple and low in cost.
Owner:广西壮族自治区农业科学院园艺研究所

A kind of expression vector construction method and kit of citrus decay virus

The invention discloses an expression vector construction method of citrus tristeza virus. The invention designs four pairs of specific primers, namely ZYC349 / ZYC350, ZYC357 / ZYC358, ZYC412 / ZYC415 and ZYC479 / ZYC480, the primers can be used for amplifying genes containing exogenous green fluorescent proteins, driving a translated citrus tristeza virus p23 gene promoter, further inserting a fragment after connection into a terminal of a p23 gene in a full-length infectious clone 35S-148 of the citrus tristeza virus by double enzyme digestion and further ensures that the citrus tristeza virus is used as an expression vector to realize stable and high-efficient expression of green fluorescent protein genes in nicotiana benthamiana for above 2 months. According to the expression vector construction method, a very important technical platform is provided for researching the distribution and the movement of the citrus tristeza virus in plants and being used as a biological reactor to realize mass expression of the high-quality proteins.
Owner:CITRUS RES INST OF CHINESE ACAD OF AGRI SCI

A liquid fertilizer capable of preventing and controlling plant diseases

The invention provides a liquid fertilizer capable of preventing plant diseases, which comprises components with parts by weight: 15-30 parts of bamboo vinegar, 30-40 parts of wood vinegar, 8-20 parts of pineapple fermentation liquor, 8-15 parts of chloroisobromine cyanuric acids, 10-20 parts of iodine and 2-20 parts of adjuvants. The liquid fertilizer capable of preventing the plant diseases creatively finds that the pineapple fermentation liquor and the bamboo vinegar has excellent treatment effect to citrus tristeza virus after being mixed, can greatly improve cure rate of the citrus tristeza virus after being applied, achieves the cure rate above 90%, even can achieve the treatment effect 100%, and has wide appliance value.
Owner:广东华汗农业科技有限公司

Molecular marker primer combination for rapidly and synchronously identifying Citrus huanglongbing, canker, Citrus tristeza virus, Citrus tatter leaf and citrus exocortis viroid, and method

The invention discloses a molecular marker primer combination for rapidly and synchronously identifying Citrus huanglongbing, canker, Citrus tristeza virus, Citrus tatter leaf and citrus exocortis viroid and an identification method. According to the invention, a synchronous rapid extraction and one-step RTPCR reaction system for RNA and DNA of citrus leaf tissues is established, a multi-specificmolecular marker primer combination capable of synchronously identifying citrus yellow shoot, canker, Citrus tristeza virus, Citrus tatter leaf and citrus exocortis viroid is developed, and the primercombination is suitable for high-throughput typing detection platforms such as fluorescent capillary electrophoresis, is high in sensitivity, and can be used for rapid identification of citrus diseases. Based on the developed molecular marker primer combination, through repeated tests and optimization, the five common citrus diseases can be synchronously detected, important technical guidance significance is achieved for detecting large-scale citrus sample plate diseases, and the advantages of being easy to operate, efficient, rapid and the like are achieved.
Owner:NINGBO ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products