Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Immuno-modulatory agents with function of preventing and curing type 2 diabetes

An immunomodulator, a technology for type 2 diabetes, which is applied in the field of immunomodulators and can solve problems such as large toxic side effects and inconvenience in use.

Inactive Publication Date: 2007-08-08
CHINA PHARM UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Commonly used clinical diabetes prevention and treatment drugs mainly include insulin and oral hypoglycemic drugs, most of which have disadvantages such as inconvenient use and large toxic and side effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Immuno-modulatory agents with function of preventing and curing type 2 diabetes
  • Immuno-modulatory agents with function of preventing and curing type 2 diabetes
  • Immuno-modulatory agents with function of preventing and curing type 2 diabetes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1: Design, synthesis and cloning of Hsp65 polypeptide gene

[0052] Genomic DNA was extracted from the commercially available BCG vaccine (refer to the "Experimental Guide for Molecular Biology" for specific steps), and the entire gene of Hsp65 in the BCG vaccine was found by the National Center for Biotechnology Information (NCBI). On the premise of not changing the amino acid sequence of Hsp65, the preferred codons of E. coli were selected, and two primers H1 and H2 were designed with the aid of computer software.

[0053] The nucleotide sequences of the two primers are as follows:

[0054] H1: 5’TTCG CCATGG CCAAGACAATTGCGTACG 3’

[0055] H2: 5’TTCCG AAGCTT AGAAATCCATGCCACCCATG 3’

[0056] The upstream primer H1 introduced the Nco I restriction site, and the downstream primer H2 introduced the Hind III restriction site.

[0057] The PCR reaction system is: 100pmol H1, 100pmol H2, 2μg BCG genomic DNA, 2μldNTP (10mM), 5μl 10×Pfu buffer and 5 units of Pfu DNA polyme...

Embodiment 2

[0059] Example 2: Expression of Hsp65 gene in E. coli

[0060] Pick a single colony from the pET28a-HspP65 plate to inoculate LB liquid medium containing 50μg / ml kanamycin, culture it overnight at 37°C with constant temperature shaking, and inoculate it into fresh corn steep liquor liquid medium (50μg / ml) at a rate of 1%. ml kanamycin), after culturing at 37°C for 4 hours, α-lactose at a final concentration of 5mmol / L was added to induce E. coli to express T7 RNA polymerase, and the culture continued to express protein Hsp65. After induction, a small amount of bacterial liquid was taken every 1 hour, and the bacterial cells were recovered by centrifugation. SDS-PAGE electrophoresis showed that the Hsp65 gene expression had been achieved. The protein reached a stable maximum expression level 6 hours after induction, and the protein accounted for about 40% of the total bacterial protein. The results are shown in Figure 3.

Embodiment 3

[0061] Example 3: Separation and purification of recombinant protein Hsp65

[0062] The engineered bacteria after induced expression were recovered by centrifugation, and the bacteria were suspended in the lysate (pH8.0, 50mmol / L phosphate buffer, 0.02% lysozyme), stirred at 37°C for 30 minutes, and added DNase I The DNA is digested until the solution is not viscous, the supernatant is recovered by centrifugation, and fractionated and precipitated with ammonium sulfate. The target protein is mainly in the 35%-45% ammonium sulfate precipitation. Re-dissolve the precipitated protein in ion exchange buffer (10mmol / L PB, pH6.8), dialysis desalting, centrifuge and take the supernatant for anion exchange column chromatography (DEAE cellulose DE-52 column, 2×60cm) , Use ion exchange buffer (10mmol / L PB, pH6.8) / NaCl gradient elution, collect in sections for SDS-PAGE electrophoresis detection, Hsp65 is in the elution peak at 80-120mmol / L NaCl. The purity of the prepared samples was checked...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an immunity adjusting agent for preventing and treating 2-type diabetes, which is the hot shock protein Hsp65 (SEQ ID NO.1) of Mycobacterium bovis. The inventive immunity adjusting agent, without additives, can use mucosa immunity path to excite the body to generate special anti-Hsp65 antibody, to reduce the generation of KK-Ay mouse diabetes. And the inventive immunity adjusting agent can be used to prevent and treat\ 2-type diabetes.

Description

Technical field: [0001] In the medical field, the present invention provides an immunomodulator for preventing and treating type 2 diabetes. Background technique: [0002] Diabetes is a clinical syndrome with high blood sugar as a common manifestation caused by the joint action of genetic and environmental factors. In recent years, the global incidence of diabetes has increased rapidly. Statistics from the World Health Organization (WHO) show that the number of people with diabetes in the world is currently 194 million and is expected to exceed 360 million by 2030. The main characteristics of type 2 diabetes are insulin resistance and absolute or relative insufficiency of insulin secretion (insulin resistance) and the resulting disorders of sugar, protein and fat metabolism, accounting for 90%-95% of the total number of diabetes. With the development of the economy, the improvement of people's living standards and the aging of the population, the number of diabetes patients in my...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K38/16A61P37/02A61P3/10C12N15/31C12P21/02
Inventor 刘景晶陈庆梅李建平熊祺琰孙云霄李祝方吴洁曹荣月
Owner CHINA PHARM UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com