Gene sequence of coding perinereis albuhitensis grube cysteine protease inhibitor and its amino acid sequence and application

The technology of cysteine ​​protease and the double-toothed nematode is applied in the field of agricultural biology, which can solve the problem that there is no coding gene of nereid cysteine ​​protease inhibitor, and achieve the effect of preventing and controlling agricultural insect pests.

Inactive Publication Date: 2008-05-28
QINGDAO UNIV
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Nereistis didentate is a marine annelid widely distributed in the coast of my country. A small peptide (nereistin) in it has been successfully u...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene sequence of coding perinereis albuhitensis grube cysteine protease inhibitor and its amino acid sequence and application
  • Gene sequence of coding perinereis albuhitensis grube cysteine protease inhibitor and its amino acid sequence and application
  • Gene sequence of coding perinereis albuhitensis grube cysteine protease inhibitor and its amino acid sequence and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Construction of the cDNA library of P. didentate worm and cloning of genes encoding cysteine ​​protease inhibitors

[0026] 1. Using 2 g of Nereis cerevisiae didentate live tissue as material, total RNA was extracted using RNAiso Reagent (TaKaRa Code No.D312).

[0027] 2. Use Oligotex-dT30 mRNA Purification Kit (TaKaRa Code No.9086) to extract mRNA.

[0028] 3. Using 5 μg mRNA as a template, use the TaKaRa cDNA library construction kit to construct a cDNA library, specifically including the following steps:

[0029] (1) Use reverse transcriptase M-MLV and Oligo (dT) anchor primer to synthesize the first strand of cDNA, using 5-methyl dCTP during synthesis;

[0030] (2) Utilize RNaseH, Escherichia coli DNA polymerase and DNA ligase to synthesize the second strand of cDNA;

[0031] (3) smoothing the ends of the double-stranded cDNA using T4 DNA polymerase;

[0032] (4) Ligate with the linker containing the NotI recognition sequence, and then digest with NotI...

Embodiment 2

[0047] Example 2: Expression of cystatin gene in Escherichia coli and purification of expression product

[0048] 1. According to the obtained cDNA sequence, design a pair of primers,

[0049] Primer 1: 5'ACATGACTACATATGGAGTCGGCAC 3'; Primer 2: 5'ACCCTCGAGCTAATTATTATTA 3'Using the cDNA of C. bidentata protease as a template, the cysteine ​​protease inhibitor gene was amplified using Taq DNA polymerase, and the amplification condition: 94 Denaturation at °C for 45 sec, annealing at 50°C for 45 sec, extension at 72°C for 45 sec. A 330bp fragment was obtained (in FIG. 1: 1. pET-15bI / XbaI, XhoI; 2. λDNA / EcoRI, HindIII).

[0050] 2. After cutting with NdeI and XhoI, clone it into the expression vector pET-15b to construct the expression vector pET-15bI, transform the expression vector into E.coliBL21(DE3), and construct the engineering bacteria.

[0051] 3. Pick a single colony of engineering bacteria, inoculate it in 20ml of LB medium containing 100μg / ml ampicillin, culture it w...

Embodiment 3

[0056] Example 3: Inhibition of papain by recombinant cysteine ​​protease inhibitors

[0057] Mix papain with recombinant proteins in different molar ratios in a buffer solution, and measure the activity of papain after incubation at 25°C for 15 min. The buffer solution used is Tris-Cl buffer solution (50mM, pH7.0, 2mM dithiothreitol , 50mMNaCl). Add 50 μl untreated or recombinant protein-treated papain (0.1 mg / ml) and 100 μl L- BAPNA (the chromogenic substrate of cysteine ​​protease, 2.0mg / ml), add 350μl of 10% hydrochloric acid solution after incubation at 37°C for 10min to terminate the reaction, measure the absorbance value at 405nm wavelength to determine the relative activity of papain. Taking the relative activity (%) of papain as ordinate, the mol ratio of recombinant protein and papain is drawing on abscissa, the result is as shown in Figure 3, along with the increase of recombinant protein mol ratio, the activity of papain reduces gradually, when When the molar rat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention relates to gene sequence and amino acid sequence of coding perinereis aibuhitensis grube cysteine protease inhibitor and insect-resistant activity of recombinant protein produced by the gene. The gene sequence and the amino acid sequence of the code protein are respectively shown like sequence 1 and sequence 2 in the chart, wherein the length of nucleotide sequence of the gene of coding perinereis aibuhitensis grube cysteine protease inhibitor is 333bp, the total length of the amino acid sequence of coding perinereis aibuhitensis grube cysteine protease inhibitor includes 110 amino acid residues, and recombinant cysteine protease inhibitor is clearly characterized by insect-resistant activity, which belongs to the field of agricultural biotechnology. Based on the gene of clamworm cysteine protease inhibitor of the invention, the coding gene of the cysteine protease inhibitor can be cloned from the cDNA library of the perinereis aibuhitensis grube. The gene of the cysteine protease inhibitor can be introduced into the plant to cultivate anti-insect plants by gene recombination technique. The gene production has recombinant clamworm cysteine protease inhibitor with insect-resistant activity, which can also be showed in other cells. The recombinant protein can be considered as novel biological pesticide to protect the agriculture from pest hazard.

Description

Technical field: [0001] The invention relates to a gene encoding a P. didentate nereis cysteine ​​protease inhibitor, its amino acid sequence and the insect-resistant activity of a recombinant protein produced by using the gene, and belongs to the field of agricultural biotechnology. Background technique: [0002] Protease inhibitors are a class of substances that can inhibit the hydrolytic activity of proteases and are widely found in animals, plants, microorganisms and humans. By binding to the active site and allosteric site of protease, they inhibit the catalytic activity of the enzyme or prevent the conversion of the zymogen into an active enzyme. These proteins in the body play an important role in regulating protein degradation, immune response and tumor metastasis. Many plant protease inhibitors also exert defense functions by inhibiting the activity of proteases in insects. According to their different substrates and their properties, protease inhibitors can be di...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/15C07K14/81A01P7/04
Inventor 李荣贵杜桂彩
Owner QINGDAO UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap