Test paper strip for rapidly detecting brucellosis IgM antibody colloidal gold
A technology for detecting brucella, which is applied in the field of brucella IgM antibody detection test strips, can solve problems such as misdiagnosis, atypical clinical symptoms, and insufficient understanding of brucellosis, and achieve clear and easy to distinguish results, Save manpower and material resources, simple operation effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Embodiment 1: the preparation of Brucella outer membrane protein bp26 genetic engineering antigen
[0030] (1) Obtaining the target gene
[0031] According to the sequence of the target gene fragment (GenBank accession number is AY166769) and the characteristics of the pGEX-4T-1 (Pharmacia) expression vector, primers containing restriction enzymes EcoR1 and Xho1 restriction sites at both ends were designed:
[0032] 5'gaattcatgaacactcgtgct3'
[0033] 5'gcctcgagttacttgatttcaa3'
[0034] Then, the target gene fragment bp26 was amplified from the Brucella genome. The amplification conditions were: denaturation at 95°C for 5 minutes; 1 minute at 95°C, 1 minute at 49.8°C, and 1 minute at 70°C for 35 cycles; finally, extension at 70°C for 10 minutes.
[0035] (2) Cloning of the target gene and screening of positive recombinants
[0036] After electrophoresis, the PCR amplified product was recovered by gel cutting, ligated with the PMD-18T cloning vector overnight at 16°C, ...
Embodiment 2
[0045] Embodiment 2: Brucella IgM antibody colloidal gold quick detection test strip (referring to Fig. 1)
[0046] (1) Preparation of colloidal gold-anti-human IgM conjugate:
[0047]It was determined by experiments that the optimal binding pH value of the anti-human IgM monoclonal antibody colloidal label was 8.0, and the ratio of colloidal gold and antibody was 28 μg / ml colloidal gold. After the labeled colloidal gold is treated with a stabilizer (0.5% BSA, pH8.0, 0.01M Tris buffer), take the colloidal gold-antibody conjugate solution in an amount of 65 μl per square centimeter, evenly adsorb on glass fiber, and freeze-dry , and stored in a dry environment.
[0048] (2) Coating antigen on nitrocellulose membrane:
[0049] Dilute bp26 to 3mg / ml with 0.01M PBS. Anti-mouse IgG was diluted to 2mg / ml with 0.01M PBS. Spray the two on the nitrocellulose membrane at a speed of 1 μl / cm with a film spraying machine to form a test line and a control line, respectively. The interv...
Embodiment 3
[0056] Embodiment 3 detection method (see figure 2 )
[0057] Add 100-150 ul of the patient's whole blood, plasma or serum specimen dropwise directly to the "4" of the test strip in Example 2, and the sample solution goes up the membrane, and the result is interpreted within 10-15 minutes.
[0058] result:
[0059] If the detection sample contains Brucella IgM antibody, it will form a corresponding complex with the colloidal gold-labeled anti-human IgM monoclonal antibody on the test strip, and the upstream is specific for Brucella coated on the nitrocellulose membrane. The antigen binds to form a red line, that is, a red band is formed at T.
[0060] Regardless of whether the specimen contains the corresponding antibody or not, the colloidal gold-labeled anti-human IgM monoclonal antibody continues to crawl upward and forms a red precipitation line with the anti-mouse IgG coated on the membrane, that is, a red band is formed at "C". This line is a quality control line. If ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
