Pseudomonas putida formaldehyde dehydrogenase gene, encoded protein and recombinant vector

A technology of Pseudomonas putida and formaldehyde dehydrogenase, applied in genetic engineering, plant gene improvement, recombinant DNA technology, etc., can solve the problems of high price and achieve high application prospects and high industrial development value

Inactive Publication Date: 2009-03-18
DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The current commercialization does not rely on GSH-type formaldehyde dehydrogenase and is expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pseudomonas putida formaldehyde dehydrogenase gene, encoded protein and recombinant vector
  • Pseudomonas putida formaldehyde dehydrogenase gene, encoded protein and recombinant vector
  • Pseudomonas putida formaldehyde dehydrogenase gene, encoded protein and recombinant vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Pseudomonas putida PFDH gene amplification

[0028]Primer design: According to the gene terminal sequences of several GSH-independent formaldehyde dehydrogenases in Pseudomonas putida reported in NCBI, two primers were designed and synthesized (the 5' end contains NdeI and XhoI restriction sites, respectively).

[0029] Sense strand primer: 5'GGAGTTCCATATGTCTGGCAATCGTGGAGTGGT3'

[0030] Antisense strand primer: 5'CCTACTCGAGCGCCGCACCCCACATCTTGTGCG3'

[0031] Colony PCR amplification: A single colony of Pseudomonas putida AS 1.643 was added to 15 μl of ultrapure water, heated at 100° C. for 5 minutes, and centrifuged at 13,000 rpm for 1 minute to obtain a lysate. For each 50 μl PCR reaction volume, add 10 μl of the above lysate as a template, 1 μl each of 25 μM sense strand primer and antisense strand primer, 1 μl 10 mM dNTP, 5 μl 10×Taq plus DNA polymerase buffer, 5 μl 100ml / LDMSO and 26.2 μl ultrapure water . Put the thin-walled tube containing the above re...

Embodiment 2

[0032] Example 2 Construction of recombinant Pseudomonas putida PFDH expression plasmid

[0033] The above PCR product was recovered, digested with NdeI / XhoI, and cloned into the prokaryotic expression vector pET24b(+) ( figure 2 ). Transform E.coli DH5α, and culture the transformant in LB medium containing kanamycin (30 μg / ml), extract the plasmid, and carry out double enzyme digestion identification with NdeI / XhoI, and a band of about 1.2 kb can be obtained ( image 3 ), proving that the recombinant plasmid has been successfully inserted into the PFDH gene fragment.

[0034] The foreign gene in the recombinant expression vector is determined by DNA sequence, and the identified length is 1197bp, and the encoded protein contains 399 amino acid residues. Sequence comparative analysis shows that the nucleotide sequence homology of this gene and the reported (ItoK.etal.J.Bacteriol.176:2483-2491, 1994) Pseudomonas putida PFDH is 85.3%, and has a typical The characteristics of ...

Embodiment 3

[0035] Example 3 Expression of recombinant PFDH

[0036] Transform pET24b-PFDH into E.coli BL21(DE3) to obtain genetically engineered bacteria. The engineered bacteria were induced and cultivated in LB medium containing kanamycin (30 μg / ml), the bacteria were collected, lysed by ultrasonic waves, and the supernatant was analyzed by SDS-PAGE, which showed that obvious specific expression product bands were obtained, and the molecular weight Consistent with the theoretical value of PFDH (43kDa) predicted by software DNAStar ( Figure 4 ), indicating that recombinant PFDH was successfully induced to express.

[0037] The culture conditions for recombinant PFDH induced expression were optimized and determined as follows: Inoculate a single colony in 70ml LB medium containing 30μg / ml kanamycin, culture overnight at 37°C, 200rpm, take 64ml of the overnight culture and inoculate it in 3.2L containing 30μg / ml kanamycin ml kanamycin LB medium, 37°C, 200rpm culture to OD 600 =0.64 (a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to a Pseudomonas putida formaldehyde dehydrogenase gene, an encoded protein and a recombinant vector. The invention uses AS 1.643 genome DNA of the Pseudomonas putida as a template, and obtains a new gene fdhA by separating the template through a PCR method so as to encode a protein formaldehyde dehydrogenase PFDH. The fdhA is cloned on an expression vector pET24b(+), and part of the formaldehyde dehydrogenase PFDH exists in Escherichia coli BL21 (DE3) in an intracellular soluble form, wherein the expression level of soluble proteins is 13.7mg / L. Through nickel affinity chromatography purification, a recombinant protein PFDH the purity of which is more than 95 percent is obtained, and the yield is 11mg / L. The recombinant protein PFDH catalyzes formaldehyde to be dehydrogenized to form formic acid in the presence of NAD<+>, wherein the highest specific activity can reach 38U / mg, and the apparent Km of the formaldehyde is between 0.100 and 0.132 mM. The recombinant protein PFDH can be applied to biological analysis process, conversion of CO2 into methanol and the biological functional studies.

Description

technical field [0001] The invention relates to the cloning, expression and biological activity of a new gene of Pseudomonas putida formaldehyde dehydrogenase, more specifically a new formaldehyde dehydrogenase gene isolated from Pseudomonas putida genome DNA, which utilizes genetic engineering methods The recombinant formaldehyde dehydrogenase with biological activity was highly expressed and purified in the Escherichia coli expression system. Background technique [0002] Formaldehyde is one of the most important chemical products. In addition to being directly used as a disinfectant, bactericide and preservative, it is also widely used in organic synthesis, synthetic materials, coatings, plastics, resins, building materials, surfactants and pesticides and other industries. Recently, new health threats related to formaldehyde have been revealed. For example, some water pretreated by advanced means, metabolites of organisms, and fruits, vegetables and meat that people oft...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/53C12N9/04C12N15/65
Inventor赵宗保王金霞
OwnerDALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI