Di-carbonyl reduction enzyme, its gene and uses thereof

A technology of carbonyl reductase and reductase, which is applied in the direction of oxidoreductase, application, genetic engineering, etc., can solve the problems of ignorance of complete gene and protein sequence, no direct evidence, etc., and achieve high efficiency, selectivity, and high selection sexual effect

Inactive Publication Date: 2011-06-15
常州金隆生物医药有限公司
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the above literature gives three short peptide sequences, the complete gene and protein sequences of the enzyme are still unknown
In addition, there is no direct evidence for whether this enzyme can directly catalyze the one-step direct reduction of dicarbonyl to a single chiral dihydroxy product

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Di-carbonyl reduction enzyme, its gene and uses thereof
  • Di-carbonyl reduction enzyme, its gene and uses thereof
  • Di-carbonyl reduction enzyme, its gene and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Cloning of Dicarbonyl Reductase Gene

[0034] 1. Bacteria and culture conditions

[0035] The strain Acinetobacter sp. ATCC33305 was purchased from ATCC in the United States and grown in the medium according to the instructions. The grown strain was stored in a glycerol cryovial at -70°C.

[0036] Glycerol cryovials were cultured in LB medium (basic components: 10g tryptone per liter, 5g yeast extract, 10g NaCl) at 37°C, 250rpm for 20 hours, then centrifuged to collect bacteria, and the method of adding lysozyme with SDS After cell disruption, genomic DNA was obtained by the phenol-chloroform method.

[0037] 2. Gene Cloning

[0038] The amino acid sequence TGITNVTV of the N-terminal part (primer NO. 1: 5'-ACIGGIATIACIAAYGTIACIGTI-3') and the known intermediate peptide sequence GELAPAK (primer NO. 2: 5'-GGIGARCTRGCICCIGCIAAR-3') are known according to dicarbonyl reductase Design random primer sets, where "A", "G", "C", "T", "I" represent adenine, guanine, ...

Embodiment 2

[0040] Example 2 Expression of double carbonyl reductase

[0041] To facilitate the expression of the dicarbonyl reductase gene, compatible restriction sites were designed at the 5' and 3' ends of the oligonucleotide primers. Its primer pair is primer NO.3 (5'-ATACGTGC CATATG ACCGGCATCACGAATGTCACCGTTCT 3') and primer NO.4 (5'-ATACGTGCAGATACGTGCA GGATCCTCAGTACCGGTAGAAGCCCTCG-3'), with NdeI and BamHI restriction sites, respectively. Using 5.2kb KpnI DNA fragment as template, primer NO.3 and primer NO.4 as primer pair, PCR amplification was carried out. After agarose gel electrophoresis, the target gene linked to the primers was recovered with a gel recovery kit. The target gene and pET22b(+) plasmid were simultaneously digested with NdeI and BamHI, respectively, and T4 DNA ligase was used for ligation reaction. After purification, the ligated product was transformed into the competent state of E. coli BL21(DE3) strain, and coated on Incubate overnight at 37°C in LB dishes c...

Embodiment 3

[0044] Example 3 Determination of the activity of dicarbonyl reductase

[0045] The activity of dicarbonyl reductase was measured by two methods: HPLC and UV absorption. The methods and results of the measurement are as follows:

[0046] 1 HPLC method

[0047] The reaction system used in this method is:

[0048] Dicarbonyl substrate 2.5mM

[0049] NAD + 0.5mM

[0050] Formate Dehydrogenase 2U

[0051] Sodium formate 200mM

[0052] Dicarbonyl Reductase 0.1-2mg

[0053] Make up to a final volume of 0.5 ml with 0.1 M phosphate buffer pH 6.0. The reaction was carried out at 28°C, 200 rpm for 18 h, and then stopped with an equal volume of ethanol. Mix well, centrifuge for 5 min, and use the supernatant for HPLC (Shimadzu, Japan) detection. The elution solvent is A. water containing 0.1% TFA; B. acetonitrile containing 0.1% TFA. The gradient of HPLC elution was 20-90% B with a gradient time of 12 min. The activity of its enzyme is 1 unit of the amount of enz...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene of dicarbonyl reductase. The nucleotide sequence of the gene has over 80 percent of homology with SEQ ID NO.1. The dicarbonyl reductase consists of an amino acid sequence having over 80 percent of homology with SEQ ID NO.2. The obtained dicarbonyl reductase can be used for a reaction of catalyzing a dicarbonyl compound to be reduced into a dicarbonyl product, and has high stereo-selectivity.

Description

technical field [0001] The present invention relates to a new gene and its protein product, in particular to a gene of dicarbonyl reductase, and to the application of the gene in catalyzing the synthesis of chiral alcohol. Background technique [0002] Chiral alcohols are an important class of intermediate compounds and are widely used in the synthesis of chiral drugs and other chiral fine chemicals. At present, it is an effective method to synthesize such compounds by biocatalysis, that is, to catalyze the reduction of carbonyl-containing substrates to corresponding chiral alcohols by specific enzymes. [0003] However, when the substrate contains two or more chiral carbonyl groups, the biocatalytic reaction will bring great difficulties due to the stereoselectivity of the enzyme. Taking 3,5-biscarbonyl-6benzyloxy-hexanoic acid ethyl ester as an example, the compound contains two carbonyl groups at the β and γ positions, and there is a problem of stereoselectivity. In thi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/53C12P7/02C12N9/02
Inventor陈依军
Owner常州金隆生物医药有限公司