Di-carbonyl reduction enzyme, its gene and uses thereof

A carbonyl reductase and reductase technology, applied in oxidoreductase, application, genetic engineering and other directions, can solve the problems of ignorance and no direct evidence of the complete gene and protein sequence, and achieve high efficiency, selectivity and high selectivity. sexual effect

Inactive Publication Date: 2009-05-13
常州金隆生物医药有限公司
View PDF1 Cites 25 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the above literature gives three short peptide sequences, the complete gene and protein sequences of the enzyme are still unknown
In addition, there is no direct evidence for whether this enzyme can directly catalyze the one-step direct reduction of dicarbonyl to a single chiral dihydroxy product

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Di-carbonyl reduction enzyme, its gene and uses thereof
  • Di-carbonyl reduction enzyme, its gene and uses thereof
  • Di-carbonyl reduction enzyme, its gene and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Cloning of the double carbonyl reductase gene

[0034] 1. Strains and culture conditions

[0035] The strain Acinetobacter sp.ATCC33305 was purchased from ATCC in the United States and grown in the medium according to the instructions. The grown strain was stored in a glycerol cryopreservation tube at -70°C.

[0036] Use LB medium (basic components: 10g tryptone, 5g yeast extract, 10g NaCl per liter) for glycerol cryopreservation tubes to culture at 37°C and 250rpm for 20 hours, then centrifuge to collect bacteria, use SDS plus lysozyme After cell disruption, genomic DNA was obtained by the phenol-chloroform method.

[0037] 2. Cloning of genes

[0038] According to the amino acid sequence of the N-terminal part of double carbonyl reductase TGITNVTV (primer NO.1: 5'-ACIGGIATIACIAAYGTIACIGTI-3') and the known intermediate peptide sequence GELAPAK (primer NO.2: 5'-GGIGARCTRGCICCIGCIAAR-3') Design a random primer set, where "A", "G", "C", "T", and "I" represe...

Embodiment 2

[0040] Example 2 Expression of dicarbonyl reductase

[0041] To facilitate the expression of the double carbonyl reductase gene, compatible restriction sites were designed at the 5' and 3' ends of the oligonucleotide primers. The primer pair is primer NO.3 (5'-ATACGTGC CATATG ACCGGCATCACGAATGTCACCGTTCT3')

[0042]and primer NO.4

[0043] (5'-ATACGTGCAGATACGTGCA GGATCC TCAGTACCGGTAGAAGCCCTCG-3'), with NdeI and BamHI restriction sites, respectively. The 5.2kb KpnI DNA fragment was used as a template, and primer No. 3 and primer No. 4 were used as a primer pair for PCR amplification. After agarose gel electrophoresis, use the gel back kit to recover the target gene of the ligated primer. Use NdeI and BamHI to digest the target gene and pET22b(+) plasmid at the same time, and perform ligation reaction with T4 DNA ligase. After purification, the ligation product is transformed into the competent strain of Escherichia coli BL21(DE3), and spread on the 100 μg / ml ampicillin LB...

Embodiment 3

[0046] Example 3 Determination of the activity of dicarbonyl reductase

[0047] The activity of dicarbonyl reductase is measured by two methods of HPLC and ultraviolet absorption, and the method and results of its measurement are as follows:

[0048] 1 HPLC method

[0049] The reaction system used in this method is:

[0050] Dicarbonyl substrate 2.5mM

[0051] NAD + 0.5mM

[0052] Formate Dehydrogenase 2U

[0053] Sodium formate 200mM

[0054] Dicarbonyl reductase 0.1-2mg

[0055] Make up to a final volume of 0.5 ml with 0.1 M pH 6.0 phosphate buffer. The reaction was carried out at 28° C. and 200 rpm for 18 h, and then terminated with an equal volume of ethanol. Mix well and centrifuge for 5 min. The supernatant is used for HPLC (Shimadzu, Japan) detection, and the elution solvent is A. water containing 0.1% TFA; B. acetonitrile containing 0.1% TFA. The gradient of HPLC elution is 20-90% B, and the gradient time is 12min. The activity of the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene of dicarbonyl reductase. The nucleotide sequence of the gene has over 80 percent of homology with SEQ ID NO.1. The dicarbonyl reductase consists of an amino acid sequence having over 80 percent of homology with SEQ ID NO.2. The obtained dicarbonyl reductase can be used for a reaction of catalyzing a dicarbonyl compound to be reduced into a dicarbonyl product, and has high stereo-selectivity.

Description

technical field [0001] The invention relates to a new gene and its protein product, in particular to a gene of a double carbonyl reductase; meanwhile, it relates to the application of the gene in catalyzing the synthesis of chiral alcohol. Background technique [0002] Chiral alcohols are an important class of intermediate compounds, widely used in the synthesis of chiral drugs and other chiral fine chemicals. At present, it is an effective method to synthesize such compounds by biocatalysis, that is, the substrate containing a carbonyl group is catalyzed by a specific enzyme to reduce it to the corresponding chiral alcohol. [0003] However, when the substrate contains two or more chiral carbonyl groups, the biocatalytic reaction will bring great difficulties because of the stereoselectivity of the enzyme. Take 3,5-biscarbonyl-6 benzyloxy-ethyl hexanoate as an example, the compound contains two carbonyl groups at the β and γ positions, and there is a problem of stereoselec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/53C12N9/02C12P7/02
Inventor陈依军
Owner常州金隆生物医药有限公司