Method for quickly detecting duck viral enteritis by real-time fluorescence quantitative PCR and kit thereof
A real-time fluorescence quantitative, duck virus enteritis technology, applied in the field of molecular biology, can solve problems such as environmental pollution, lack of management experience, improper epidemic prevention measures, etc., to eliminate false negative problems, improve compatibility, and stabilize biological characteristics Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Example 1 Real-time fluorescent quantitative PCR rapid detection of duck viral enteritis positive quality control standard - preparation of recombinant plasmid pMD18-T-DEV76bp
[0054] Primers and Taqman probes were designed according to the conserved sequence DEVUL31 gene
[0055] Primer FP (37421-37440) 5'-ACGCTGTCCACGTCAGTTTG-3'
[0056] Primer RP (37475-37496) 5′-TGGCTCATGTTTGGCATTCTAC-3′
[0057] Probe probe(37448-37470) 5′-FCGGTCGCGCCTCACGACAAGTAP-3
[0058] The 5' end of the probe sequence is labeled with FAM (indicated by F), and the 3' end is labeled with TAQMAN (indicated by P);
[0059] Duck viral enteritis chick embryonized attenuated vaccine strain was purchased from China Veterinary Drug Control Institute, and genomic DNA was extracted with the DNA extraction kit of Treasure Bioengineering (Dalian) Co., Ltd.;
[0060] Press the table:
[0061]
[0062] reaction system;
[0063] The reaction conditions are: 94°C for 2min; 94°C for 30s, 58°C for 30s,...
Embodiment 2
[0071] Example 2 Using the recombinant plasmid pMD18-T-DEV76bp as a template, routine PCR verification primer specificity test
[0072] Use the recombinant plasmid pMD18-T-DEV76bp as a template, and use the following primers:
[0073] FP (37421-37440) 5′-ACGCTGTCCACGTCAGTTTG-3′
[0074] RP (37475-37496) 5′-TGGCTCATGTTTGGCATTCTAC-3′
[0075] According to the reaction system:
[0076] Routine PCR verification primer specificity test target gene amplification system
[0077]
[0078] PCR reaction program according to the table
[0079]
[0080] Perform conventional PCR amplification; get a band that matches the expected size (76bp), the band is specific, and the primers do not have dimers, such as image 3 ;
[0081] Perform electrophoresis on the PCR amplified product on 1% low-melting point agarose gel, and excise the target band; recover the target DNA according to the instructions of the Micro Gel Recovery Kit; purify the target DNA 4.5 μL, T vector 0.5 Mix μL and...
Embodiment 3
[0083] Example 3 Preparation of quantitative positive quality control standard pMD18-T-DEV76bp
[0084] The Escherichia coli competent cell DH5α containing the recombinant plasmid pMD18-T-DEV76bp frozen in Example 2 was transferred to the + 60μg / ml LB liquid medium, 250r / min shaking enrichment culture overnight, transfer the cultured overnight bacterial solution to LB liquid medium, 250r / min shaking enrichment culture for 2-3 hours, and then use TaKaRa company plasmid extraction The kit extracts the plasmid; take 10 μL of the plasmid sample, dilute it with 1990 μL of double-distilled water, take 70 μL and transfer it to a 1.0 cm quartz cuvette, and measure A260 on a UV spectrophotometer; the amount of DNA in the sample can be calculated according to the absorbance value of A260 Content, that is, 1 OD value is equivalent to 50ug / ml double-stranded DNA; then,
[0085] According to the formula: Calculate the plasmid concentration,
[0086] According to the formula: Calculat...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com