Efficient production method and application of antibacterial peptide plectasin

A production method and antimicrobial peptide technology, applied in the field of high-efficiency production of fungal defensin antimicrobial peptide plectasin, can solve the problems of uneven secretion and expression products, incomplete signal peptide processing, low protein expression, etc., and achieve the goal of being suitable for large-scale industrialization The effect of production, low price, and simple purification operation

Inactive Publication Date: 2010-10-27
SOUTH CHINA AGRI UNIV
View PDF1 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] However, the current yeast expression system of antimicrobial peptides is basically based on methanol induction, and there are many techni

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Efficient production method and application of antibacterial peptide plectasin
  • Efficient production method and application of antibacterial peptide plectasin
  • Efficient production method and application of antibacterial peptide plectasin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1: the preparation of antimicrobial peptide (fungus defensin) plectasin

[0030] pGAPZαA, Puc18, and Pichia pastoris SMD1168 were all purchased from Invitrogen.

[0031] (1) Construction of expression vector: According to the partial tropism of the Pichia pastoris gene and the amino acid sequence of the antimicrobial peptide plectasin, the multiple cloning sites on the pGAPZαA plasmid vector map were designed and the plectasin nucleic acid was synthesized on the plasmid Puc18 vector. The gene of this example was synthesized on the Pucl8 vector by Shanghai Yingjun Company.

[0032] The sequences of four primers were designed as follows:

[0033] Primer P1: Plectasin-P1: 5'CCCTCGAGAAAAGAGGTTTTGGTTGTAAC3'

[0034] Primer P2: Plectasin-P2: 5'GCTCTAGATCAGTAACACTTACAAACAAAACC3'

[0035] Primer P3: Plectasin-P3: 5'GTCCCTATTTCAATCAAT3'

[0036] Primer P4: Plectasin-P4: 5'ACCCTTAGCACAGTAACC3'

[0037] The enzyme cutting sites are Xho Ⅰ and Xba Ⅰ, and the expressi...

Embodiment 2

[0052] Antimicrobial identification by agarose diffusion (Agarose diffusion antimicrobial assay) (US Patent 6,337,314, January 8, 2002).

[0053] Obtain the antimicrobial peptide plectasin expressed by genetic engineering according to the method of Example 1, with representative standard Staphylococcus aureus S.aureus and the Streptococcus suis clinically isolated in this laboratory (also can adopt the general laboratory routine of prior art field Streptococcus suis) was used for antibacterial identification, and those skilled in the art can refer to this embodiment for experiments on other bacteria, and will not repeat them here one by one. Suspensions of Staphylococcus aureus and Streptococcus suis in the logarithmic growth phase (OD 600 ≈0.5) each 15 μL, mixed with 30 mL of LB solid medium at 55 °C and plated, waited for it to solidify, punched holes with a sterilized puncher (diameter 3 mm), added dropwise 50 μL of the plectasin sample to be tested, 37 °C Cultivate overni...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an efficient production method and application of antibacterial peptide plectasin. The efficient production method comprises the following steps of: establishing a pGAPZaA-plectasin eukaryon expression vector, transforming the eukaryon expression vector into host cells, i.e. pichiapastoris to establish expression engineering bacteria, fermenting and culturing the expression engineering bacteria, centrifuging expression culture medium to obtain supernate, and purifying the supernate to obtain the antibacterial peptide plectasin. The antibacterial peptide plectasin can be applied to prepare antibacterial agents or feed additive or preservative, and has good resistance on staphylococcus aureus or streptococcus suis. The invention has the advantages of simple operation and lower cost.

Description

technical field [0001] The invention belongs to the technical field of biogenetic engineering, and in particular relates to an antibacterial peptide expression technology, in particular to a high-efficiency production method and application of a fungal defensin antibacterial peptide plectasin. Background technique [0002] At present, almost all conventional antibiotics have corresponding drug-resistant pathogenic strains, and the problem of drug resistance of pathogenic bacteria has become an increasingly serious threat to the health of animals and humans. Finding new types of antibiotics is an effective way to solve the problem of drug resistance. Antimicrobial peptides are a class of biologically active small peptides that widely exist in the biological world. They are a kind of antibacterial active peptides produced by cells and tissues of microorganisms, plants, invertebrates and various animals. important parts of. Prior art studies have found that antimicrobial pept...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/81C12N1/19C07K14/47A61K38/16A61P31/04A23K1/16A23L3/3526
Inventor 黄毓茂刘德辉何俊
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap