Efficient production method and application of antibacterial peptide plectasin
A production method and antimicrobial peptide technology, applied in the field of high-efficiency production of fungal defensin antimicrobial peptide plectasin, can solve the problems of uneven secretion and expression products, incomplete signal peptide processing, low protein expression, etc., and achieve the goal of being suitable for large-scale industrialization The effect of production, low price, and simple purification operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Embodiment 1: the preparation of antimicrobial peptide (fungus defensin) plectasin
[0030] pGAPZαA, Puc18, and Pichia pastoris SMD1168 were all purchased from Invitrogen.
[0031] (1) Construction of expression vector: According to the partial tropism of the Pichia pastoris gene and the amino acid sequence of the antimicrobial peptide plectasin, the multiple cloning sites on the pGAPZαA plasmid vector map were designed and the plectasin nucleic acid was synthesized on the plasmid Puc18 vector. The gene of this example was synthesized on the Pucl8 vector by Shanghai Yingjun Company.
[0032] The sequences of four primers were designed as follows:
[0033] Primer P1: Plectasin-P1: 5'CCCTCGAGAAAAGAGGTTTTGGTTGTAAC3'
[0034] Primer P2: Plectasin-P2: 5'GCTCTAGATCAGTAACACTTACAAACAAAACC3'
[0035] Primer P3: Plectasin-P3: 5'GTCCCTATTTCAATCAAT3'
[0036] Primer P4: Plectasin-P4: 5'ACCCTTAGCACAGTAACC3'
[0037] The enzyme cutting sites are Xho Ⅰ and Xba Ⅰ, and the expressi...
Embodiment 2
[0052] Antimicrobial identification by agarose diffusion (Agarose diffusion antimicrobial assay) (US Patent 6,337,314, January 8, 2002).
[0053] Obtain the antimicrobial peptide plectasin expressed by genetic engineering according to the method of Example 1, with representative standard Staphylococcus aureus S.aureus and the Streptococcus suis clinically isolated in this laboratory (also can adopt the general laboratory routine of prior art field Streptococcus suis) was used for antibacterial identification, and those skilled in the art can refer to this embodiment for experiments on other bacteria, and will not repeat them here one by one. Suspensions of Staphylococcus aureus and Streptococcus suis in the logarithmic growth phase (OD 600 ≈0.5) each 15 μL, mixed with 30 mL of LB solid medium at 55 °C and plated, waited for it to solidify, punched holes with a sterilized puncher (diameter 3 mm), added dropwise 50 μL of the plectasin sample to be tested, 37 °C Cultivate overni...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap